Human CTBP2(C-Terminal Binding Protein 2) ELISA Kit

Human CTBP2(C-Terminal Binding Protein 2) ELISA Kit

To Order: Contact us

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

RDR-CTBP2-Hu-96Tests 96 Tests
EUR 756

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

RD-CTBP2-Hu-48Tests 48 Tests
EUR 521

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

RD-CTBP2-Hu-96Tests 96 Tests
EUR 723

Human C terminal binding protein 2(CTBP2) ELISA kit

E01C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C terminal binding protein 2(CTBP2) ELISA kit

E01C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C terminal binding protein 2(CTBP2) ELISA kit

E01C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

20-abx151198
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human C- terminal- binding protein 2, CTBP2 ELISA KIT

ELI-47631h 96 Tests
EUR 824

Human C-Terminal Binding Protein 2(CTBP2)ELISA Kit

QY-E01352 96T
EUR 361

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

SEF359Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C-Terminal Binding Protein 2 (CTBP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C-Terminal Binding Protein 2 (CTBP2) in Tissue homogenates and other biological fluids.

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

SEF359Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C-Terminal Binding Protein 2 (CTBP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C-Terminal Binding Protein 2 (CTBP2) in Tissue homogenates and other biological fluids.

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

SEF359Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C-Terminal Binding Protein 2 (CTBP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C-Terminal Binding Protein 2 (CTBP2) in Tissue homogenates and other biological fluids.

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

SEF359Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C-Terminal Binding Protein 2 (CTBP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C-Terminal Binding Protein 2 (CTBP2) in Tissue homogenates and other biological fluids.

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

4-SEF359Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as C-Terminal Binding Protein 2 elisa. Alternative names of the recognized antigen: Ribeye
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human C-Terminal Binding Protein 2 (CTBP2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human C-Terminal Binding Protein 2 (CTBP2) Protein

20-abx166003
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat C terminal binding protein 2(CTBP2) ELISA kit

E02C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C terminal binding protein 2(CTBP2) ELISA kit

E02C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C terminal binding protein 2(CTBP2) ELISA kit

E02C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C terminal binding protein 2(CTBP2) ELISA kit

E03C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C terminal binding protein 2(CTBP2) ELISA kit

E03C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C terminal binding protein 2(CTBP2) ELISA kit

E03C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat C terminal binding protein 2(CTBP2) ELISA kit

E06C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat C terminal binding protein 2(CTBP2) ELISA kit

E06C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat C terminal binding protein 2(CTBP2) ELISA kit

E06C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C terminal binding protein 2(CTBP2) ELISA kit

E04C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C terminal binding protein 2(CTBP2) ELISA kit

E04C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C terminal binding protein 2(CTBP2) ELISA kit

E04C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C terminal binding protein 2(CTBP2) ELISA kit

E09C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C terminal binding protein 2(CTBP2) ELISA kit

E09C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C terminal binding protein 2(CTBP2) ELISA kit

E09C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C terminal binding protein 2(CTBP2) ELISA kit

E08C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C terminal binding protein 2(CTBP2) ELISA kit

E08C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C terminal binding protein 2(CTBP2) ELISA kit

E08C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C terminal binding protein 2(CTBP2) ELISA kit

E07C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C terminal binding protein 2(CTBP2) ELISA kit

E07C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C terminal binding protein 2(CTBP2) ELISA kit

E07C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C- terminal- binding protein 2, Ctbp2 ELISA KIT

ELI-08869m 96 Tests
EUR 865

Bovine C- terminal- binding protein 2, CTBP2 ELISA KIT

ELI-26454b 96 Tests
EUR 928

Rat C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

abx391161-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

abx388936-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

C-Terminal-Binding Protein 2 (CTBP2) Antibody

20-abx007537
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 2 (CTBP2) Antibody

20-abx111833
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 2 (CtBP2) Antibody

20-abx119059
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 2 (CTBP2) Antibody

20-abx128275
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

C-Terminal Binding Protein 2 (CTBP2) Antibody

20-abx171955
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

C-Terminal Binding Protein 2 (CTBP2) Antibody

20-abx241209
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 2 (CTBP2) Antibody

20-abx241865
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 2 (CTBP2) Antibody

20-abx242204
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 2 (CTBP2) Antibody

20-abx329639
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 2 (CTBP2) Antibody

abx232047-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

C-Terminal-Binding Protein 2 (CTBP2) Antibody

20-abx001840
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant C-Terminal Binding Protein 2 (CTBP2)

4-RPF359Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P56545
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human C-Terminal Binding Protein 2 expressed in: E.coli

ELISA kit for Human CTBP2 (C-Terminal Binding Protein 2)

ELK3604 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to C-Terminal Binding Protein 2 (CTBP2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of C-Terminal Binding Protein 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human C-Terminal Binding Protein 2 (CTBP2) CLIA Kit

20-abx494880
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Ctbp2 ELISA Kit| Rat C-terminal-binding protein 2 ELISA Kit

EF018515 96 Tests
EUR 689

Ctbp2 ELISA Kit| Mouse C-terminal-binding protein 2 ELISA Kit

EF014563 96 Tests
EUR 689

CTBP2 ELISA Kit| Bovine C-terminal-binding protein 2 ELISA Kit

EF011261 96 Tests
EUR 689

Guinea pig C terminal binding protein 2(CTBP2) ELISA kit

E05C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig C terminal binding protein 2(CTBP2) ELISA kit

E05C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig C terminal binding protein 2(CTBP2) ELISA kit

E05C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig)

4-PAF359Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2)

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig), APC

4-PAF359Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2). This antibody is labeled with APC.

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig), Biotinylated

4-PAF359Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2). This antibody is labeled with Biotin.

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig), Cy3

4-PAF359Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2). This antibody is labeled with Cy3.

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig), FITC

4-PAF359Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2). This antibody is labeled with FITC.

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig), HRP

4-PAF359Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2). This antibody is labeled with HRP.

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig), PE

4-PAF359Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2). This antibody is labeled with PE.

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig), APC-Cy7

4-PAF359Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2). This antibody is labeled with APC-Cy7.

Ctbp2/ Rat Ctbp2 ELISA Kit

ELI-26865r 96 Tests
EUR 886

CTBP2 ELISA KIT|Human

EF008897 96 Tests
EUR 689

Human C terminal binding protein 1(CTBP1) ELISA kit

E01C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C terminal binding protein 1(CTBP1) ELISA kit

E01C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C terminal binding protein 1(CTBP1) ELISA kit

E01C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C-Terminal Binding Protein 1 (CTBP1) ELISA Kit

abx386717-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human C- terminal- binding protein 1, CTBP1 ELISA KIT

ELI-32073h 96 Tests
EUR 824

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

CTBP2 ELISA Kit (Human) (OKCD00970)

OKCD00970 96 Wells
EUR 831
Description: Description of target: Corepressor targeting diverse transcription regulators. Functions in brown adipose tissue (BAT) differentiation (By similarity).By similarity Isoform 2 probably acts as a scaffold for specialized synapses. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.125 ng/mL

Topoisomerase IIα C-terminal Peptide

TG2011-2 50 ug
EUR 436

C-Terminal Binding Protein 1 Protein

20-abx260578
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

Rat C terminal binding protein 1(CTBP1) ELISA kit

E02C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C terminal binding protein 1(CTBP1) ELISA kit

E02C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C terminal binding protein 1(CTBP1) ELISA kit

E02C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C terminal binding protein 1(CTBP1) ELISA kit

E03C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C terminal binding protein 1(CTBP1) ELISA kit

E03C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C terminal binding protein 1(CTBP1) ELISA kit

E03C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat C terminal binding protein 1(CTBP1) ELISA kit

E06C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat C terminal binding protein 1(CTBP1) ELISA kit

E06C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat C terminal binding protein 1(CTBP1) ELISA kit

E06C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C terminal binding protein 1(CTBP1) ELISA kit

E04C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C terminal binding protein 1(CTBP1) ELISA kit

E04C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C terminal binding protein 1(CTBP1) ELISA kit

E04C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C terminal binding protein 1(CTBP1) ELISA kit

E09C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C terminal binding protein 1(CTBP1) ELISA kit

E09C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C terminal binding protein 1(CTBP1) ELISA kit

E09C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C terminal binding protein 1(CTBP1) ELISA kit

E08C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C terminal binding protein 1(CTBP1) ELISA kit

E08C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C terminal binding protein 1(CTBP1) ELISA kit

E08C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C terminal binding protein 1(CTBP1) ELISA kit

E07C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C terminal binding protein 1(CTBP1) ELISA kit

E07C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C terminal binding protein 1(CTBP1) ELISA kit

E07C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C-Terminal Binding Protein 1 (CTBP1) ELISA Kit

abx391160-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse C-Terminal Binding Protein 1 (CTBP1) ELISA Kit

abx388935-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse C- terminal- binding protein 1, Ctbp1 ELISA KIT

ELI-47630m 96 Tests
EUR 865

Recombinant Human C-Terminal Binding Protein 1

7-04915 5µg Ask for price

Recombinant Human C-Terminal Binding Protein 1

7-04916 25µg Ask for price

Recombinant Human C-Terminal Binding Protein 1

7-04917 1mg Ask for price

Ctbp1 ELISA Kit| Rat C-terminal-binding protein 1 ELISA Kit

EF018514 96 Tests
EUR 689

Ctbp1 ELISA Kit| Mouse C-terminal-binding protein 1 ELISA Kit

EF014562 96 Tests
EUR 689

Human C-Terminal Binding Protein 1 (CTBP1) Protein

20-abx168952
  • EUR 578.00
  • EUR 258.00
  • EUR 1706.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea pig C terminal binding protein 1(CTBP1) ELISA kit

E05C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig C terminal binding protein 1(CTBP1) ELISA kit

E05C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig C terminal binding protein 1(CTBP1) ELISA kit

E05C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CTBP2 Protein Vector (Human) (pPB-C-His)

PV011045 500 ng
EUR 329

CTBP2 Protein Vector (Human) (pPM-C-HA)

PV011047 500 ng
EUR 329

CTBP2 Protein Vector (Human) (pPM-C-His)

PV011048 500 ng
EUR 329

CTBP2 Protein Vector (Human) (pPB-C-His)

PV011049 500 ng
EUR 329

CTBP2 Protein Vector (Human) (pPM-C-HA)

PV011051 500 ng
EUR 329

CTBP2 Protein Vector (Human) (pPM-C-His)

PV011052 500 ng
EUR 329

CTBP1 C-Terminal Binding Protein 1 Human Recombinant Protein

PROTQ13363 Regular: 25ug
EUR 317
Description: CTBP1 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 440 amino acids (1-440 a.a.) and having a molecular mass of 47.5kDa.;CTBP1 is purified by proprietary chromatographic techniques.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

abx025989-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

abx025989-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx214101
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx111832
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

20-abx121379
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

20-abx126875
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx130699
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

abx145059-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx137368
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CtBP1) Antibody

abx140039-01mg 0.1 mg
EUR 425
  • Shipped within 5-12 working days.

C-Terminal-Binding Protein 1 (CtBP1) Antibody

20-abx012973
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

abx028520-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

abx028520-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dnak Substrate Binding Domain C-terminal Protein

20-abx263150
  • EUR 328.00
  • EUR 1372.00
  • EUR 230.00
  • 100 ug
  • 1 mg
  • 20 ug
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx241960
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx242203
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx242239
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

20-abx321412
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

abx331536-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx328471
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

abx232046-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

20-abx001431
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant C-Terminal Binding Protein 1 (CTBP1)

4-RPC409Hu01
  • EUR 410.02
  • EUR 212.00
  • EUR 1262.56
  • EUR 487.52
  • EUR 875.04
  • EUR 337.00
  • EUR 3006.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13363
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human C-Terminal Binding Protein 1 expressed in: E.coli

Recombinant Human CTBP2

P1746 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P56545
Description: Recombinant Human protein for CTBP2

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human)

4-PAC409Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1)

Recombinant human Sterol regulatory element-binding protein 2 (SREBP2) protein control for WB

SREBP23-C 100 ul
EUR 286

FABP4 Fatty Acid Binding Protein 4 Human

PROTP15090-2 Regular: 10ug
EUR 317
Description: The Human FABP4 produced from Human Adipose Tissue has a molecular mass of 14.587kDa (calculated without glycosylation) containing 131 amino acid residues.

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

CTBP2 antibody

22082-100ul 100ul
EUR 390

CTBP2 antibody

70R-16641 50 ul
EUR 435
Description: Rabbit polyclonal CTBP2 antibody

CtBP2 antibody

70R-12678 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal CtBP2 antibody

CtBP2 antibody

70R-31783 100 ug
EUR 327
Description: Rabbit polyclonal CtBP2 antibody

CtBP2 antibody

70R-14092 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal CtBP2 antibody

CTBP2 Antibody

35698-100ul 100ul
EUR 252

CTBP2 Antibody

1-CSB-PA006136GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CTBP2. Recognizes CTBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CTBP2 Antibody

1-CSB-PA062537
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CTBP2. Recognizes CTBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

CTBP2 Antibody

1-CSB-PA784650
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CTBP2. Recognizes CTBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

CtBP2 Antibody

DF8648 200ul
EUR 304
Description: CtBP2 Antibody detects endogenous levels of total CtBP2.

CTBP2 Antibody

1-CSB-PA549967
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CTBP2. Recognizes CTBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CTBP2 antibody

70R-51511 100 ul
EUR 244
Description: Purified Polyclonal CTBP2 antibody

CTBP2 Antibody

1-CSB-PA007414
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CTBP2. Recognizes CTBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

CTBP2 siRNA

20-abx901314
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CTBP2 siRNA

20-abx913061
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CTBP2 siRNA

20-abx913062
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CtBP2 Antibody

ABD8648 100 ug
EUR 438

anti-CTBP2

YF-PA11173 50 ug
EUR 363
Description: Mouse polyclonal to CTBP2

anti-CTBP2

YF-PA11174 100 ug
EUR 403
Description: Rabbit polyclonal to CTBP2

anti-CTBP2

YF-PA23538 50 ul
EUR 334
Description: Mouse polyclonal to CTBP2

anti-CTBP2

YF-PA23539 50 ul
EUR 334
Description: Mouse polyclonal to CTBP2

Human c-terminal aggregated protein fragments ELISA kit

E01C2697-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human c-terminal aggregated protein fragments in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human c-terminal aggregated protein fragments ELISA kit

E01C2697-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human c-terminal aggregated protein fragments in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human c-terminal aggregated protein fragments ELISA kit

E01C2697-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human c-terminal aggregated protein fragments in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant (NSO) purified Human Insulin Like Growth Factor Binding Protein-2 (IGFBP-2) protein control for WB

IGFBP22-C 100 ul
EUR 286

CTBP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0524703 1.0 ug DNA
EUR 154

CTBP2 Protein Vector (Mouse) (pPB-C-His)

PV168630 500 ng
EUR 1065

CTBP2 Protein Vector (Mouse) (pPM-C-HA)

PV168632 500 ng
EUR 1065

CTBP2 Protein Vector (Mouse) (pPM-C-His)

PV168633 500 ng
EUR 1065

CTBP2 Protein Vector (Mouse) (pPB-C-His)

PV168634 500 ng
EUR 603

CTBP2 Protein Vector (Mouse) (pPM-C-HA)

PV168636 500 ng
EUR 603

CTBP2 Protein Vector (Mouse) (pPM-C-His)

PV168637 500 ng
EUR 603

CTBP2 Protein Vector (Rat) (pPB-C-His)

PV262170 500 ng
EUR 1166

CTBP2 Protein Vector (Rat) (pPM-C-HA)

PV262172 500 ng
EUR 1166

CTBP2 Protein Vector (Rat) (pPM-C-His)

PV262173 500 ng
EUR 1166

Recombinant purified Human Carboxyl Terminal Modulator Protein (CTMP) protein for Western blot

CTMP11-C 100 ul
EUR 286

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), APC

4-PAC409Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with APC.

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), Biotinylated

4-PAC409Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with Biotin.

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), Cy3

4-PAC409Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with Cy3.

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), FITC

4-PAC409Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with FITC.

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), HRP

4-PAC409Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with HRP.

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), PE

4-PAC409Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with PE.

Human CTBP2 shRNA Plasmid

20-abx951052
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GATA Binding Protein 2 ELISA kit

E01G0086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 2 ELISA kit

E01G0086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 2 ELISA kit

E01G0086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 2 ELISA kit

E01U0015-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human UL16 Binding protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 2 ELISA kit

E01U0015-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human UL16 Binding protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 2 ELISA kit

E01U0015-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human UL16 Binding protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin Binding Protein 2 ELISA kit

E01T0100-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin Binding Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin Binding Protein 2 ELISA kit

E01T0100-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin Binding Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin Binding Protein 2 ELISA kit

E01T0100-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin Binding Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mannose Binding Lectin 2 (Protein C) (MBL2) ELISA Kit

abx517122-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human C Jun amino terminal kinase interacting protein 2(MAPK8IP2) ELISA kit

E01C2334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human C Jun amino terminal kinase interacting protein 2(MAPK8IP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C Jun amino terminal kinase interacting protein 2(MAPK8IP2) ELISA kit

E01C2334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human C Jun amino terminal kinase interacting protein 2(MAPK8IP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C Jun amino terminal kinase interacting protein 2(MAPK8IP2) ELISA kit

E01C2334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human C Jun amino terminal kinase interacting protein 2(MAPK8IP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human MBP-C/MBL2 (Mannose Binding Protein C/Mannose Binding Lectin 2)

E-EL-H1305 1 plate of 96 wells
EUR 534
  • Gentaur's MBP-C/MBL2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MBP-C/MBL2. Standards or samples are added to the micro ELISA plate wells and comb
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MBP-C/MBL2 (Mannose Binding Protein C/Mannose Binding Lectin 2) in samples from Serum, Plasma, Cell supernatant

N-Terminal Ef-Hand Calcium Binding Protein 2 Antibody

20-abx114158
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Human ALS2 C terminal like protein(ALS2CL) ELISA kit

E01A1409-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ALS2 C terminal like protein(ALS2CL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ALS2 C terminal like protein(ALS2CL) ELISA kit

E01A1409-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ALS2 C terminal like protein(ALS2CL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ALS2 C terminal like protein(ALS2CL) ELISA kit

E01A1409-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ALS2 C terminal like protein(ALS2CL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human LRRN4 C- terminal- like protein, LRRN4CL ELISA KIT

ELI-16001h 96 Tests
EUR 824

Human MICAL C- terminal- like protein, MICALCL ELISA KIT

ELI-19514h 96 Tests
EUR 824

Human MICAL C-terminal-like protein (MICALCL) ELISA Kit

abx385153-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human ALS2 C- terminal- like protein, ALS2CL ELISA KIT

ELI-49877h 96 Tests
EUR 824

S100A8 Human, S100 Calcium Binding Protein A8, His-Myc Tag Human Recombinant Protein

PROTP05109-2 Regular: 20ug
EUR 317
Description: S100A8 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 127 amino acids (1-93) and having a molecular mass of 14.5kDa.  S100A8 is fused to a 24 aa His-tag at N-terminus and to a 10 aa Myc-tag at C-terminus.

Recombinant (NSO) purified Mouse Insulin Like Growth Factor Binding Protein-2 (IGFBP-2) protein control for WB

IGFBP23-C 100 ul
EUR 286

Anti-CAS9 N-terminal Monoclonal Antibody

M30929-2 100ul
EUR 397
Description: Mouse Monoclonal CAS9 N-terminal Antibody. Validated in IHC, WB and tested in Streptococcus pyogenes.

Human Apolipoprotein C-I (Apo C1) AssayMax ELISA Kit

EA8011-2 96 Well Plate
EUR 417

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), APC-Cy7

4-PAC409Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with APC-Cy7.

CtBP2 Blocking Peptide

DF8648-BP 1mg
EUR 195

CTBP2 Polyclonal Antibody

A-2740 100 µl
EUR 724.25
Description: Ask the seller for details

CTBP2 Blocking Peptide

20-abx062086
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CTBP2 Conjugated Antibody

C35698 100ul
EUR 397

CTBP2 cloning plasmid

CSB-CL006136HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1338
  • Sequence: atggcccttgtggataagcacaaagtcaagagacagcgattggacagaatttgtgaaggtatccgcccccagatcatgaacggccccctgcacccccgccccctggtggcgctgctggacggccgcgactgcactgtggagatgcccatcctgaaggacctggccactgtggcct
  • Show more
Description: A cloning plasmid for the CTBP2 gene.

CTBP2 cloning plasmid

CSB-CL006136HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1542
  • Sequence: atgagaccaggacttccaggccccacagggttgtgcgctcagacctcaagtaggggccagaagagtgtactgaaacagaaggaatcttgtggaatttggcagttgtaccattttcttagcagaaaacaggagcccaggtgggagccatgtgtgtcgggttcctcgtcaggtgacg
  • Show more
Description: A cloning plasmid for the CTBP2 gene.

CtBP2 Polyclonal Antibody

ABP53885-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CtBP2 at AA rangle: 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of CtBP2 from Human, Mouse, Rat. This CtBP2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CtBP2 at AA rangle: 370-450

CtBP2 Polyclonal Antibody

ABP53885-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CtBP2 at AA rangle: 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of CtBP2 from Human, Mouse, Rat. This CtBP2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CtBP2 at AA rangle: 370-450

CtBP2 Polyclonal Antibody

ABP53885-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CtBP2 at AA rangle: 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of CtBP2 from Human, Mouse, Rat. This CtBP2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CtBP2 at AA rangle: 370-450

CTBP2 Rabbit pAb

A2257-100ul 100 ul
EUR 308

CTBP2 Rabbit pAb

A2257-200ul 200 ul
EUR 459

CTBP2 Rabbit pAb

A2257-20ul 20 ul
EUR 183

CTBP2 Rabbit pAb

A2257-50ul 50 ul
EUR 223

CTBP2 Rabbit pAb

A16826-100ul 100 ul
EUR 308

CTBP2 Rabbit pAb

A16826-200ul 200 ul
EUR 459

CTBP2 Rabbit pAb

A16826-20ul 20 ul
EUR 183

CTBP2 Rabbit pAb

A16826-50ul 50 ul
EUR 223

CtBP2 Polyclonal Antibody

ES4884-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CtBP2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

CtBP2 Polyclonal Antibody

ES4884-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CtBP2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

anti- CTBP2 antibody

FNab02047 100µg
EUR 505.25
  • Immunogen: C-terminal binding protein 2
  • Uniprot ID: P56545
  • Gene ID: 1488
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against CTBP2

Anti-CTBP2 Antibody

PA1554 100ug/vial
EUR 334

Anti-CTBP2 antibody

PAab02047 100 ug
EUR 355

Anti-CTBP2 Antibody

PB9426 100ug/vial
EUR 334

Human CTBP2(C-Terminal Binding Protein 2) ELISA Kit