Human CTBP2(C-Terminal Binding Protein 2) ELISA Kit

Human CTBP2(C-Terminal Binding Protein 2) ELISA Kit

To Order: Contact us

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

RDR-CTBP2-Hu-96Tests 96 Tests
EUR 756

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

RD-CTBP2-Hu-48Tests 48 Tests
EUR 521

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

RD-CTBP2-Hu-96Tests 96 Tests
EUR 723

Human C terminal binding protein 2(CTBP2) ELISA kit

E01C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C terminal binding protein 2(CTBP2) ELISA kit

E01C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C terminal binding protein 2(CTBP2) ELISA kit

E01C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C- terminal- binding protein 2, CTBP2 ELISA KIT

ELI-47631h 96 Tests
EUR 824

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

20-abx151198
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human C-Terminal Binding Protein 2(CTBP2)ELISA Kit

QY-E01352 96T
EUR 361

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

SEF359Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C-Terminal Binding Protein 2 (CTBP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C-Terminal Binding Protein 2 (CTBP2) in Tissue homogenates and other biological fluids.

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

SEF359Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C-Terminal Binding Protein 2 (CTBP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C-Terminal Binding Protein 2 (CTBP2) in Tissue homogenates and other biological fluids.

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

SEF359Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C-Terminal Binding Protein 2 (CTBP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C-Terminal Binding Protein 2 (CTBP2) in Tissue homogenates and other biological fluids.

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

SEF359Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C-Terminal Binding Protein 2 (CTBP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C-Terminal Binding Protein 2 (CTBP2) in Tissue homogenates and other biological fluids.

Human C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

4-SEF359Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as C-Terminal Binding Protein 2 elisa. Alternative names of the recognized antigen: Ribeye
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human C-Terminal Binding Protein 2 (CTBP2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human C-Terminal Binding Protein 2 (CTBP2) Protein

20-abx166003
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Goat C terminal binding protein 2(CTBP2) ELISA kit

E06C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat C terminal binding protein 2(CTBP2) ELISA kit

E06C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat C terminal binding protein 2(CTBP2) ELISA kit

E06C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C terminal binding protein 2(CTBP2) ELISA kit

E02C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C terminal binding protein 2(CTBP2) ELISA kit

E02C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C terminal binding protein 2(CTBP2) ELISA kit

E02C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C terminal binding protein 2(CTBP2) ELISA kit

E03C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C terminal binding protein 2(CTBP2) ELISA kit

E03C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C terminal binding protein 2(CTBP2) ELISA kit

E03C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C terminal binding protein 2(CTBP2) ELISA kit

E04C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C terminal binding protein 2(CTBP2) ELISA kit

E04C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C terminal binding protein 2(CTBP2) ELISA kit

E04C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C terminal binding protein 2(CTBP2) ELISA kit

E08C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C terminal binding protein 2(CTBP2) ELISA kit

E08C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C terminal binding protein 2(CTBP2) ELISA kit

E08C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C terminal binding protein 2(CTBP2) ELISA kit

E09C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C terminal binding protein 2(CTBP2) ELISA kit

E09C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C terminal binding protein 2(CTBP2) ELISA kit

E09C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C terminal binding protein 2(CTBP2) ELISA kit

E07C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C terminal binding protein 2(CTBP2) ELISA kit

E07C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C terminal binding protein 2(CTBP2) ELISA kit

E07C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine C- terminal- binding protein 2, CTBP2 ELISA KIT

ELI-26454b 96 Tests
EUR 928

Mouse C- terminal- binding protein 2, Ctbp2 ELISA KIT

ELI-08869m 96 Tests
EUR 865

Mouse C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

abx388936-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat C-Terminal Binding Protein 2 (CTBP2) ELISA Kit

abx391161-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

C-Terminal-Binding Protein 2 (CtBP2) Antibody

20-abx119059
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 2 (CTBP2) Antibody

20-abx111833
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 2 (CTBP2) Antibody

20-abx128275
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

C-Terminal-Binding Protein 2 (CTBP2) Antibody

20-abx001840
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 2 (CTBP2) Antibody

20-abx007537
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 2 (CTBP2) Antibody

20-abx329639
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 2 (CTBP2) Antibody

20-abx241209
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 2 (CTBP2) Antibody

20-abx241865
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 2 (CTBP2) Antibody

20-abx242204
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 2 (CTBP2) Antibody

abx232047-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

C-Terminal Binding Protein 2 (CTBP2) Antibody

20-abx171955
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant C-Terminal Binding Protein 2 (CTBP2)

4-RPF359Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P56545
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human C-Terminal Binding Protein 2 expressed in: E.coli

ELISA kit for Human CTBP2 (C-Terminal Binding Protein 2)

ELK3604 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to C-Terminal Binding Protein 2 (CTBP2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of C-Terminal Binding Protein 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human C-Terminal Binding Protein 2 (CTBP2) CLIA Kit

20-abx494880
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Ctbp2 ELISA Kit| Rat C-terminal-binding protein 2 ELISA Kit

EF018515 96 Tests
EUR 689

Ctbp2 ELISA Kit| Mouse C-terminal-binding protein 2 ELISA Kit

EF014563 96 Tests
EUR 689

CTBP2 ELISA Kit| Bovine C-terminal-binding protein 2 ELISA Kit

EF011261 96 Tests
EUR 689

Guinea pig C terminal binding protein 2(CTBP2) ELISA kit

E05C2145-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig C terminal binding protein 2(CTBP2) ELISA kit

E05C2145-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig C terminal binding protein 2(CTBP2) ELISA kit

E05C2145-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig C terminal binding protein 2(CTBP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig)

4-PAF359Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2)

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig), APC

4-PAF359Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2). This antibody is labeled with APC.

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig), Biotinylated

4-PAF359Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2). This antibody is labeled with Biotin.

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig), Cy3

4-PAF359Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2). This antibody is labeled with Cy3.

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig), FITC

4-PAF359Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2). This antibody is labeled with FITC.

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig), HRP

4-PAF359Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2). This antibody is labeled with HRP.

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig), PE

4-PAF359Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2). This antibody is labeled with PE.

C-Terminal Binding Protein 2 (CTBP2) Polyclonal Antibody (Human, Pig), APC-Cy7

4-PAF359Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP2 (Met1~Leu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig C-Terminal Binding Protein 2 (CTBP2). This antibody is labeled with APC-Cy7.

Ctbp2/ Rat Ctbp2 ELISA Kit

ELI-26865r 96 Tests
EUR 886

CTBP2 ELISA KIT|Human

EF008897 96 Tests
EUR 689

Human C terminal binding protein 1(CTBP1) ELISA kit

E01C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C terminal binding protein 1(CTBP1) ELISA kit

E01C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C terminal binding protein 1(CTBP1) ELISA kit

E01C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C- terminal- binding protein 1, CTBP1 ELISA KIT

ELI-32073h 96 Tests
EUR 824

Human C-Terminal Binding Protein 1 (CTBP1) ELISA Kit

abx386717-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

CTBP2 ELISA Kit (Human) (OKCD00970)

OKCD00970 96 Wells
EUR 831
Description: Description of target: Corepressor targeting diverse transcription regulators. Functions in brown adipose tissue (BAT) differentiation (By similarity).By similarity Isoform 2 probably acts as a scaffold for specialized synapses. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.125 ng/mL

Topoisomerase IIα C-terminal Peptide

TG2011-2 50 ug
EUR 436

C-Terminal Binding Protein 1 Protein

20-abx260578
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

Goat C terminal binding protein 1(CTBP1) ELISA kit

E06C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat C terminal binding protein 1(CTBP1) ELISA kit

E06C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat C terminal binding protein 1(CTBP1) ELISA kit

E06C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C terminal binding protein 1(CTBP1) ELISA kit

E02C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C terminal binding protein 1(CTBP1) ELISA kit

E02C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C terminal binding protein 1(CTBP1) ELISA kit

E02C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C terminal binding protein 1(CTBP1) ELISA kit

E03C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C terminal binding protein 1(CTBP1) ELISA kit

E03C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C terminal binding protein 1(CTBP1) ELISA kit

E03C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C terminal binding protein 1(CTBP1) ELISA kit

E04C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C terminal binding protein 1(CTBP1) ELISA kit

E04C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C terminal binding protein 1(CTBP1) ELISA kit

E04C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C terminal binding protein 1(CTBP1) ELISA kit

E08C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C terminal binding protein 1(CTBP1) ELISA kit

E08C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C terminal binding protein 1(CTBP1) ELISA kit

E08C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C terminal binding protein 1(CTBP1) ELISA kit

E09C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C terminal binding protein 1(CTBP1) ELISA kit

E09C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C terminal binding protein 1(CTBP1) ELISA kit

E09C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C terminal binding protein 1(CTBP1) ELISA kit

E07C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C terminal binding protein 1(CTBP1) ELISA kit

E07C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C terminal binding protein 1(CTBP1) ELISA kit

E07C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C- terminal- binding protein 1, Ctbp1 ELISA KIT

ELI-47630m 96 Tests
EUR 865

Mouse C-Terminal Binding Protein 1 (CTBP1) ELISA Kit

abx388935-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat C-Terminal Binding Protein 1 (CTBP1) ELISA Kit

abx391160-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Recombinant Human C-Terminal Binding Protein 1

7-04915 5µg Ask for price

Recombinant Human C-Terminal Binding Protein 1

7-04916 25µg Ask for price

Recombinant Human C-Terminal Binding Protein 1

7-04917 1mg Ask for price

Ctbp1 ELISA Kit| Rat C-terminal-binding protein 1 ELISA Kit

EF018514 96 Tests
EUR 689

Ctbp1 ELISA Kit| Mouse C-terminal-binding protein 1 ELISA Kit

EF014562 96 Tests
EUR 689

Human C-Terminal Binding Protein 1 (CTBP1) Protein

20-abx168952
  • EUR 578.00
  • EUR 258.00
  • EUR 1706.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea pig C terminal binding protein 1(CTBP1) ELISA kit

E05C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig C terminal binding protein 1(CTBP1) ELISA kit

E05C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig C terminal binding protein 1(CTBP1) ELISA kit

E05C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CTBP2 Protein Vector (Human) (pPB-C-His)

PV011045 500 ng
EUR 329

CTBP2 Protein Vector (Human) (pPM-C-HA)

PV011047 500 ng
EUR 329

CTBP2 Protein Vector (Human) (pPM-C-His)

PV011048 500 ng
EUR 329

CTBP2 Protein Vector (Human) (pPB-C-His)

PV011049 500 ng
EUR 329

CTBP2 Protein Vector (Human) (pPM-C-HA)

PV011051 500 ng
EUR 329

CTBP2 Protein Vector (Human) (pPM-C-His)

PV011052 500 ng
EUR 329

CTBP1 C-Terminal Binding Protein 1 Human Recombinant Protein

PROTQ13363 Regular: 25ug
EUR 317
Description: CTBP1 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 440 amino acids (1-440 a.a.) and having a molecular mass of 47.5kDa.;CTBP1 is purified by proprietary chromatographic techniques.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

20-abx126875
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx111832
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx130699
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

20-abx121379
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

20-abx001431
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx137368
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CtBP1) Antibody

abx140039-01mg 0.1 mg
EUR 425
  • Shipped within 5-12 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

abx145059-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CtBP1) Antibody

20-abx012973
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

abx025989-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

abx025989-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

abx028520-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

abx028520-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

20-abx321412
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx328471
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx214101
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

abx331536-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx241960
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx242203
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-Terminal Binding Protein 1 (CTBP1) Antibody

20-abx242239
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dnak Substrate Binding Domain C-terminal Protein

20-abx263150
  • EUR 328.00
  • EUR 1372.00
  • EUR 230.00
  • 100 ug
  • 1 mg
  • 20 ug
  • Shipped within 5-10 working days.

C-Terminal-Binding Protein 1 (CTBP1) Antibody

abx232046-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant C-Terminal Binding Protein 1 (CTBP1)

4-RPC409Hu01
  • EUR 410.02
  • EUR 212.00
  • EUR 1262.56
  • EUR 487.52
  • EUR 875.04
  • EUR 337.00
  • EUR 3006.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13363
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human C-Terminal Binding Protein 1 expressed in: E.coli

Recombinant Human CTBP2

P1746 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P56545
Description: Recombinant Human protein for CTBP2

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human)

4-PAC409Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1)

Recombinant human Sterol regulatory element-binding protein 2 (SREBP2) protein control for WB

SREBP23-C 100 ul
EUR 286

FABP4 Fatty Acid Binding Protein 4 Human

PROTP15090-2 Regular: 10ug
EUR 317
Description: The Human FABP4 produced from Human Adipose Tissue has a molecular mass of 14.587kDa (calculated without glycosylation) containing 131 amino acid residues.

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

CTBP2 siRNA

20-abx901314
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CTBP2 siRNA

20-abx913061
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CTBP2 siRNA

20-abx913062
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CTBP2 antibody

70R-51511 100 ul
EUR 244
Description: Purified Polyclonal CTBP2 antibody

CtBP2 antibody

70R-31783 100 ug
EUR 327
Description: Rabbit polyclonal CtBP2 antibody

CtBP2 Antibody

ABD8648 100 ug
EUR 438

CTBP2 Antibody

35698-100ul 100ul
EUR 252

CTBP2 antibody

22082-100ul 100ul
EUR 390

CtBP2 antibody

70R-12678 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal CtBP2 antibody

CtBP2 antibody

70R-14092 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal CtBP2 antibody

CTBP2 antibody

70R-16641 50 ul
EUR 435
Description: Rabbit polyclonal CTBP2 antibody

CtBP2 Antibody

DF8648 200ul
EUR 304
Description: CtBP2 Antibody detects endogenous levels of total CtBP2.

CTBP2 Antibody

1-CSB-PA006136GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CTBP2. Recognizes CTBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CTBP2 Antibody

1-CSB-PA007414
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CTBP2. Recognizes CTBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

CTBP2 Antibody

1-CSB-PA784650
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CTBP2. Recognizes CTBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

CTBP2 Antibody

1-CSB-PA549967
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CTBP2. Recognizes CTBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CTBP2 Antibody

1-CSB-PA062537
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CTBP2. Recognizes CTBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

anti-CTBP2

YF-PA11173 50 ug
EUR 363
Description: Mouse polyclonal to CTBP2

anti-CTBP2

YF-PA11174 100 ug
EUR 403
Description: Rabbit polyclonal to CTBP2

anti-CTBP2

YF-PA23538 50 ul
EUR 334
Description: Mouse polyclonal to CTBP2

anti-CTBP2

YF-PA23539 50 ul
EUR 334
Description: Mouse polyclonal to CTBP2

Recombinant (NSO) purified Human Insulin Like Growth Factor Binding Protein-2 (IGFBP-2) protein control for WB

IGFBP22-C 100 ul
EUR 286

Human c-terminal aggregated protein fragments ELISA kit

E01C2697-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human c-terminal aggregated protein fragments in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human c-terminal aggregated protein fragments ELISA kit

E01C2697-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human c-terminal aggregated protein fragments in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human c-terminal aggregated protein fragments ELISA kit

E01C2697-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human c-terminal aggregated protein fragments in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CTBP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0524703 1.0 ug DNA
EUR 154

CTBP2 Protein Vector (Mouse) (pPB-C-His)

PV168630 500 ng
EUR 1065

CTBP2 Protein Vector (Mouse) (pPM-C-HA)

PV168632 500 ng
EUR 1065

CTBP2 Protein Vector (Mouse) (pPM-C-His)

PV168633 500 ng
EUR 1065

CTBP2 Protein Vector (Mouse) (pPB-C-His)

PV168634 500 ng
EUR 603

CTBP2 Protein Vector (Mouse) (pPM-C-HA)

PV168636 500 ng
EUR 603

CTBP2 Protein Vector (Mouse) (pPM-C-His)

PV168637 500 ng
EUR 603

CTBP2 Protein Vector (Rat) (pPB-C-His)

PV262170 500 ng
EUR 1166

CTBP2 Protein Vector (Rat) (pPM-C-HA)

PV262172 500 ng
EUR 1166

CTBP2 Protein Vector (Rat) (pPM-C-His)

PV262173 500 ng
EUR 1166

Recombinant purified Human Carboxyl Terminal Modulator Protein (CTMP) protein for Western blot

CTMP11-C 100 ul
EUR 286

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), APC

4-PAC409Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with APC.

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), Biotinylated

4-PAC409Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with Biotin.

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), Cy3

4-PAC409Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with Cy3.

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), FITC

4-PAC409Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with FITC.

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), HRP

4-PAC409Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with HRP.

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), PE

4-PAC409Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with PE.

Human CTBP2 shRNA Plasmid

20-abx951052
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Mannose Binding Lectin 2 (Protein C) (MBL2) ELISA Kit

abx517122-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human UL16 Binding protein 2 ELISA kit

E01U0015-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human UL16 Binding protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 2 ELISA kit

E01U0015-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human UL16 Binding protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 2 ELISA kit

E01U0015-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human UL16 Binding protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin Binding Protein 2 ELISA kit

E01T0100-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin Binding Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin Binding Protein 2 ELISA kit

E01T0100-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin Binding Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin Binding Protein 2 ELISA kit

E01T0100-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin Binding Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 2 ELISA kit

E01G0086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 2 ELISA kit

E01G0086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 2 ELISA kit

E01G0086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C Jun amino terminal kinase interacting protein 2(MAPK8IP2) ELISA kit

E01C2334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human C Jun amino terminal kinase interacting protein 2(MAPK8IP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C Jun amino terminal kinase interacting protein 2(MAPK8IP2) ELISA kit

E01C2334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human C Jun amino terminal kinase interacting protein 2(MAPK8IP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C Jun amino terminal kinase interacting protein 2(MAPK8IP2) ELISA kit

E01C2334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human C Jun amino terminal kinase interacting protein 2(MAPK8IP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human MBP-C/MBL2 (Mannose Binding Protein C/Mannose Binding Lectin 2)

E-EL-H1305 1 plate of 96 wells
EUR 534
  • Gentaur's MBP-C/MBL2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MBP-C/MBL2. Standards or samples are added to the micro ELISA plate wells and comb
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MBP-C/MBL2 (Mannose Binding Protein C/Mannose Binding Lectin 2) in samples from Serum, Plasma, Cell supernatant

N-Terminal Ef-Hand Calcium Binding Protein 2 Antibody

20-abx114158
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Human ALS2 C terminal like protein(ALS2CL) ELISA kit

E01A1409-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ALS2 C terminal like protein(ALS2CL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ALS2 C terminal like protein(ALS2CL) ELISA kit

E01A1409-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ALS2 C terminal like protein(ALS2CL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ALS2 C terminal like protein(ALS2CL) ELISA kit

E01A1409-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ALS2 C terminal like protein(ALS2CL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human MICAL C- terminal- like protein, MICALCL ELISA KIT

ELI-19514h 96 Tests
EUR 824

Human LRRN4 C- terminal- like protein, LRRN4CL ELISA KIT

ELI-16001h 96 Tests
EUR 824

Human ALS2 C- terminal- like protein, ALS2CL ELISA KIT

ELI-49877h 96 Tests
EUR 824

Human MICAL C-terminal-like protein (MICALCL) ELISA Kit

abx385153-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

S100A8 Human, S100 Calcium Binding Protein A8, His-Myc Tag Human Recombinant Protein

PROTP05109-2 Regular: 20ug
EUR 317
Description: S100A8 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 127 amino acids (1-93) and having a molecular mass of 14.5kDa.  S100A8 is fused to a 24 aa His-tag at N-terminus and to a 10 aa Myc-tag at C-terminus.

Recombinant (NSO) purified Mouse Insulin Like Growth Factor Binding Protein-2 (IGFBP-2) protein control for WB

IGFBP23-C 100 ul
EUR 286

Anti-CAS9 N-terminal Monoclonal Antibody

M30929-2 100ul
EUR 397
Description: Mouse Monoclonal CAS9 N-terminal Antibody. Validated in IHC, WB and tested in Streptococcus pyogenes.

Human Apolipoprotein C-I (Apo C1) AssayMax ELISA Kit

EA8011-2 96 Well Plate
EUR 417

C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), APC-Cy7

4-PAC409Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with APC-Cy7.

CTBP2 Conjugated Antibody

C35698 100ul
EUR 397

CTBP2 cloning plasmid

CSB-CL006136HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1338
  • Sequence: atggcccttgtggataagcacaaagtcaagagacagcgattggacagaatttgtgaaggtatccgcccccagatcatgaacggccccctgcacccccgccccctggtggcgctgctggacggccgcgactgcactgtggagatgcccatcctgaaggacctggccactgtggcct
  • Show more
Description: A cloning plasmid for the CTBP2 gene.

CTBP2 cloning plasmid

CSB-CL006136HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1542
  • Sequence: atgagaccaggacttccaggccccacagggttgtgcgctcagacctcaagtaggggccagaagagtgtactgaaacagaaggaatcttgtggaatttggcagttgtaccattttcttagcagaaaacaggagcccaggtgggagccatgtgtgtcgggttcctcgtcaggtgacg
  • Show more
Description: A cloning plasmid for the CTBP2 gene.

anti- CTBP2 antibody

FNab02047 100µg
EUR 505.25
  • Immunogen: C-terminal binding protein 2
  • Uniprot ID: P56545
  • Gene ID: 1488
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against CTBP2

CtBP2 Polyclonal Antibody

ES4884-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CtBP2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

CtBP2 Polyclonal Antibody

ES4884-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CtBP2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

CTBP2 Blocking Peptide

20-abx062086
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CtBP2 Polyclonal Antibody

ABP53885-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CtBP2 at AA rangle: 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of CtBP2 from Human, Mouse, Rat. This CtBP2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CtBP2 at AA rangle: 370-450

CtBP2 Polyclonal Antibody

ABP53885-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CtBP2 at AA rangle: 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of CtBP2 from Human, Mouse, Rat. This CtBP2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CtBP2 at AA rangle: 370-450

CtBP2 Polyclonal Antibody

ABP53885-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CtBP2 at AA rangle: 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of CtBP2 from Human, Mouse, Rat. This CtBP2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CtBP2 at AA rangle: 370-450

CTBP2 Polyclonal Antibody

A-2740 100 µl
EUR 724.25
Description: Ask the seller for details

CTBP2 Rabbit pAb

A16826-100ul 100 ul
EUR 308

CTBP2 Rabbit pAb

A16826-200ul 200 ul
EUR 459

CTBP2 Rabbit pAb

A16826-20ul 20 ul
EUR 183

CTBP2 Rabbit pAb

A16826-50ul 50 ul
EUR 223

CTBP2 Rabbit pAb

A2257-100ul 100 ul
EUR 308

CTBP2 Rabbit pAb

A2257-200ul 200 ul
EUR 459

CTBP2 Rabbit pAb

A2257-20ul 20 ul
EUR 183

CTBP2 Rabbit pAb

A2257-50ul 50 ul
EUR 223

CtBP2 Blocking Peptide

DF8648-BP 1mg
EUR 195

Anti-CTBP2 Antibody

PB9426 100ug/vial
EUR 334

Anti-CTBP2 antibody

PAab02047 100 ug
EUR 355

Anti-CTBP2 Antibody

PA1554 100ug/vial
EUR 334

Human CTBP2(C-Terminal Binding Protein 2) ELISA Kit