Human PCDHb16(Protocadherin Beta 16) ELISA Kit

Human PCDHb16(Protocadherin Beta 16) ELISA Kit

To Order: Contact us

Human Protocadherin Beta 16 (PCDHb16) ELISA Kit
DLR-PCDHb16-Hu-96T 96T
EUR 673
  • Should the Human Protocadherin Beta 16 (PCDHb16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protocadherin Beta 16 (PCDHb16) in samples from tissue homogenates or other biological fluids.
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit
RD-PCDHb16-Hu-48Tests 48 Tests
EUR 521
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit
RD-PCDHb16-Hu-96Tests 96 Tests
EUR 723
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit
RDR-PCDHb16-Hu-48Tests 48 Tests
EUR 544
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit
RDR-PCDHb16-Hu-96Tests 96 Tests
EUR 756
Human Protocadherin beta- 16, PCDHB16 ELISA KIT
ELI-14608h 96 Tests
EUR 824
Human Protocadherin beta 16 (PCDHb16) ELISA Kit
20-abx152867
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Protocadherin Beta 16 (PCDHB16) ELISA Kit
abx252906-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit
SEE072Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 16 (PCDHb16) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 16 (PCDHb16) in Tissue homogenates and other biological fluids.
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit
SEE072Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 16 (PCDHb16) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 16 (PCDHb16) in Tissue homogenates and other biological fluids.
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit
SEE072Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 16 (PCDHb16) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 16 (PCDHb16) in Tissue homogenates and other biological fluids.
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit
SEE072Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 16 (PCDHb16) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 16 (PCDHb16) in Tissue homogenates and other biological fluids.
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit
4-SEE072Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Protocadherin Beta 16 elisa. Alternative names of the recognized antigen: PCDHB8a
  • PCDH3X
  • PCDH-BETA16
  • ME1
  • Cadherin ME1
  • Protocadherin-3x
  • PCDHbeta 16
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protocadherin Beta 16 (PCDHb16) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Protocadherin Beta 16 (PCDHb16) Antibody
20-abx128255
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Protocadherin Beta 16 (PCDHB16) Antibody
abx036812-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Protocadherin Beta 16 (PCDHb16) Antibody
20-abx174304
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Protocadherin Beta 16 (PCDHB16) Antibody
20-abx338812
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protocadherin Beta 16 (PCDHB16) Antibody
20-abx210548
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Protocadherin Beta 16 (PCDHb16)
4-RPE072Hu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NRJ7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Protocadherin Beta 16 expressed in: E.coli
Pig Protocadherin Beta 16 (PCDHB16) ELISA Kit
abx360691-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Protocadherin Beta 16 (PCDHB16) ELISA Kit
abx363526-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Sheep Protocadherin Beta 16 (PCDHB16) ELISA Kit
abx364605-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.
Monkey Protocadherin Beta 16 (PCDHB16) ELISA Kit
abx359041-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Chicken Protocadherin Beta 16 (PCDHB16) ELISA Kit
abx355520-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Protocadherin Beta 16 (PCDHb16) Protein
20-abx168211
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Protocadherin Beta 16 (PCDHb16) CLIA Kit
abx196151-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Protocadherin beta 16 (PCDHb16) CLIA Kit
20-abx494493
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human PCDHb16 (Protocadherin Beta 16)
ELK3563 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protocadherin Beta 16 (PCDH?16). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pr
  • Show more
Description: A sandwich ELISA kit for detection of Protocadherin Beta 16 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Protocadherin beta-16 (PCDHB16)
KTE61296-48T 48T
EUR 332
  • PCDHb16 is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene cluste
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin beta-16 (PCDHB16) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protocadherin beta-16 (PCDHB16)
KTE61296-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PCDHb16 is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene cluste
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin beta-16 (PCDHB16) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protocadherin beta-16 (PCDHB16)
KTE61296-96T 96T
EUR 539
  • PCDHb16 is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene cluste
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin beta-16 (PCDHB16) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Protocadherin Beta 16 (PCDHB16) Antibody (HRP)
20-abx337354
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protocadherin Beta 16 (PCDHB16) Antibody (FITC)
20-abx337355
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protocadherin Beta 16 (PCDHB16) Antibody (Biotin)
20-abx337356
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human)
4-PAE072Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDHb16 (Val35~Val347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16)
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human), APC
4-PAE072Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDHb16 (Val35~Val347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16). This antibody is labeled with APC.
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human), Biotinylated
4-PAE072Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDHb16 (Val35~Val347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16). This antibody is labeled with Biotin.
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human), Cy3
4-PAE072Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDHb16 (Val35~Val347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16). This antibody is labeled with Cy3.
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human), FITC
4-PAE072Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDHb16 (Val35~Val347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16). This antibody is labeled with FITC.
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human), HRP
4-PAE072Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDHb16 (Val35~Val347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16). This antibody is labeled with HRP.
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human), PE
4-PAE072Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDHb16 (Val35~Val347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16). This antibody is labeled with PE.
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human), APC-Cy7
4-PAE072Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDHb16 (Val35~Val347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16). This antibody is labeled with APC-Cy7.
Human PCDHβ16(Protocadherin Beta 16) ELISA Kit
EH3516 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9NRJ7
  • Alias: PCDHβ16
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
ELISA kit for Human PCDH?16 (Protocadherin Beta 16)
E-EL-H0938 1 plate of 96 wells
EUR 534
  • Gentaur's PCDH?16 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PCDH?16. Standards or samples are added to the micro ELISA plate wells and combined w
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PCDH?16 (Protocadherin Beta 16) in samples from Serum, Plasma, Cell supernatant
CLIA kit for Human PCDH?16 (Protocadherin Beta 16)
E-CL-H0639 1 plate of 96 wells
EUR 584
  • Gentaur's PCDH?16 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PCDH?16 . Standards or samples are added to the micro CLIA plate wells and combined wit
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human PCDH?16 (Protocadherin Beta 16) in samples from Serum, Plasma, Cell supernatant
Human Protocadherin- 16, DCHS1 ELISA KIT
ELI-43183h 96 Tests
EUR 824
99445-16 DCT 16 X 100MM
99445-16 250/pk
EUR 96
Description: Disposable Culture Tubes; DCT's, CGW
Recombinant human Protocadherin-16
P1565 100ug Ask for price
  • Uniprot ID: Q96JQ0
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Protocadherin-16
ELISA kit for Human Protocadherin-16 (DCHS1)
KTE62136-48T 48T
EUR 332
  • DCHS1 is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family m
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin-16 (DCHS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protocadherin-16 (DCHS1)
KTE62136-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DCHS1 is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family m
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin-16 (DCHS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protocadherin-16 (DCHS1)
KTE62136-96T 96T
EUR 539
  • DCHS1 is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family m
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin-16 (DCHS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Protocadherin-16 Antibody
abx019160-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.
Protocadherin-16 Antibody
48035-100ul 100ul
EUR 333
Protocadherin-16 Antibody
48035-50ul 50ul
EUR 239
Nucleo 9 Line 16 ELISA kit
55R-ORG711/16 16 Tests
EUR 399
Description: ELISA kit for the detection of Nucleo 9 Line 16 in the research laboratory
ANA 9 Line Immunoblot 16 ELISA kit
55R-ORG710/16 16 Tests
EUR 399
Description: ELISA kit for the detection of ANA 9 Line Immunoblot 16 in the research laboratory
IFN beta 1b, Interferon beta 1b, human
RC217-16 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines
Human Protocadherin beta- 10, PCDHB10 ELISA KIT
ELI-12387h 96 Tests
EUR 824
Human Protocadherin beta- 15, PCDHB15 ELISA KIT
ELI-14582h 96 Tests
EUR 824
Human Protocadherin beta- 4, PCDHB4 ELISA KIT
ELI-14604h 96 Tests
EUR 824
Human Protocadherin beta- 5, PCDHB5 ELISA KIT
ELI-14605h 96 Tests
EUR 824
Human Protocadherin beta- 9, PCDHB9 ELISA KIT
ELI-14606h 96 Tests
EUR 824
Human Protocadherin beta- 14, PCDHB14 ELISA KIT
ELI-14607h 96 Tests
EUR 824
Human Protocadherin beta- 13, PCDHB13 ELISA KIT
ELI-35635h 96 Tests
EUR 824
Human Protocadherin beta- 11, PCDHB11 ELISA KIT
ELI-35666h 96 Tests
EUR 824
Human Protocadherin beta- 12, PCDHB12 ELISA KIT
ELI-35667h 96 Tests
EUR 824
Human Protocadherin beta- 6, PCDHB6 ELISA KIT
ELI-37488h 96 Tests
EUR 824
Human Protocadherin beta- 3, PCDHB3 ELISA KIT
ELI-43150h 96 Tests
EUR 824
Human Protocadherin beta- 1, PCDHB1 ELISA KIT
ELI-45007h 96 Tests
EUR 824
Human Protocadherin beta- 7, PCDHB7 ELISA KIT
ELI-45008h 96 Tests
EUR 824
Human Protocadherin beta- 2, PCDHB2 ELISA KIT
ELI-45082h 96 Tests
EUR 824
Human Protocadherin beta- 8, PCDHB8 ELISA KIT
ELI-37796h 96 Tests
EUR 824
Human Protocadherin Beta 15 (PCDHB15) ELISA Kit
20-abx156781
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Protocadherin Beta 2 (PCDHB2) ELISA Kit
abx352089-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Protocadherin Beta 12 (PCDHB12) ELISA Kit
abx382091-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Protocadherin Beta 5 (PCDHB5) ELISA Kit
abx382092-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Protocadherin Beta 9(PCDHb9)ELISA Kit
QY-E00354 96T
EUR 361
Human Protocadherin Beta 8(PCDHb8)ELISA Kit
QY-E00355 96T
EUR 361
Human Protocadherin Beta 7(PCDHb7)ELISA Kit
QY-E00356 96T
EUR 361
Human Protocadherin Beta 6(PCDHb6)ELISA Kit
QY-E00357 96T
EUR 361
Human Protocadherin Beta 5(PCDHb5)ELISA Kit
QY-E00358 96T
EUR 361
Human Protocadherin Beta 4(PCDHb4)ELISA Kit
QY-E00359 96T
EUR 361
Human Protocadherin Beta 3(PCDHb3)ELISA Kit
QY-E00360 96T
EUR 361
Human Protocadherin Beta 15(PCDHb15)ELISA Kit
QY-E00361 96T
EUR 361
Human Protocadherin Beta 14(PCDHb14)ELISA Kit
QY-E00362 96T
EUR 361
Human Protocadherin Beta 13(PCDHb13)ELISA Kit
QY-E00363 96T
EUR 361
Human Protocadherin Beta 12(PCDHb12)ELISA Kit
QY-E00364 96T
EUR 361
Human Protocadherin Beta 11(PCDHb11)ELISA Kit
QY-E00365 96T
EUR 361
Human Protocadherin Beta 10(PCDHb10)ELISA Kit
QY-E00366 96T
EUR 361
Human Protocadherin Beta 1(PCDHb1)ELISA Kit
QY-E00367 96T
EUR 361
Human Protocadherin Beta 15 (PCDHb15) ELISA Kit
SEE075Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 15 (PCDHb15) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 15 (PCDHb15) in Tissue homogenates, cell lysates and other biological fluids.
Human Protocadherin Beta 15 (PCDHb15) ELISA Kit
SEE075Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 15 (PCDHb15) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 15 (PCDHb15) in Tissue homogenates, cell lysates and other biological fluids.
Human Protocadherin Beta 15 (PCDHb15) ELISA Kit
SEE075Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 15 (PCDHb15) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 15 (PCDHb15) in Tissue homogenates, cell lysates and other biological fluids.
Human Protocadherin Beta 15 (PCDHb15) ELISA Kit
SEE075Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 15 (PCDHb15) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 15 (PCDHb15) in Tissue homogenates, cell lysates and other biological fluids.
Human Protocadherin Beta 15 (PCDHb15) ELISA Kit
4-SEE075Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Protocadherin Beta 15 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protocadherin Beta 15 (PCDHb15) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
PCDHB16 ELISA Kit (Human) (OKCD00415)
OKCD00415 96 Wells
EUR 831
Description: Description of target: Potential calcium-dependent cell-adhesion protein. May be involved in the establishment and maintenance of specific neuronal connections in the brain. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL
PCDHb16 ELISA Kit (Human) (OKDD00458)
OKDD00458 96 Wells
EUR 975
Description: Description of target: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL
RA420A-miR-16 QuantiMir miR-16 --50 assays
RA420A-miR-16 50 assays
EUR 151
  • Category: MicroRNA Tools
Human Putative protocadherin beta- 18, PCDHB18 ELISA KIT
ELI-22837h 96 Tests
EUR 824
ELISA kit for Human PCDHb15 (Protocadherin Beta 15)
ELK5035 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protocadherin Beta 15 (PCDH?15). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pr
  • Show more
Description: A sandwich ELISA kit for detection of Protocadherin Beta 15 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Protocadherin beta-15 (PCDHB15)
KTE61297-48T 48T
EUR 332
  • Protocadherin beta-15 is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell recept
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin beta-15 (PCDHB15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protocadherin beta-15 (PCDHB15)
KTE61297-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Protocadherin beta-15 is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell recept
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin beta-15 (PCDHB15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protocadherin beta-15 (PCDHB15)
KTE61297-96T 96T
EUR 539
  • Protocadherin beta-15 is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell recept
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin beta-15 (PCDHB15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
0.5-10UL ADJUSTABLE VOLUME 16 CHANNEL AXYPET PIPETTOR
AP-16 1/pk
EUR 625
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Monkey Protocadherin Beta 2 (PCDHB2) ELISA Kit
abx360057-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Protocadherin Beta 2 (PCDHB2) ELISA Kit
abx361798-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Protocadherin Beta 2 (PCDHB2) ELISA Kit
abx362649-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Protocadherin beta- 14, Pcdhb14 ELISA KIT
ELI-16098m 96 Tests
EUR 865
Chicken Protocadherin Beta 2 (PCDHB2) ELISA Kit
abx356573-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
99449 DSSCT 16 X 100MM W/O MARKING SPOT
99449-16 250/pk
EUR 295
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock
Human Protocadherin Beta 15 (PCDHB15) CLIA Kit
20-abx494494
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human PCDH?2 (Protocadherin Beta 2)
E-EL-H2265 1 plate of 96 wells
EUR 534
  • Gentaur's PCDH?2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PCDH?2. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PCDH?2 (Protocadherin Beta 2) in samples from Serum, Plasma, Cell supernatant
anti-Protocadherin beta 13
YF-PA19964 50 ul
EUR 363
Description: Mouse polyclonal to Protocadherin beta 13
anti-Protocadherin beta 13
YF-PA19965 50 ug
EUR 363
Description: Mouse polyclonal to Protocadherin beta 13
anti-Protocadherin beta 12
YF-PA26402 50 ul
EUR 334
Description: Mouse polyclonal to Protocadherin beta 12
anti-protocadherin beta 10
YF-PA26404 50 ul
EUR 334
Description: Mouse polyclonal to protocadherin beta 10
anti-Protocadherin beta 3
YF-PA26406 50 ul
EUR 334
Description: Mouse polyclonal to Protocadherin beta 3
99448 DSSCT 16 X 125MM FLAT BOTTOM W/O MARKING SPOT
99448-16 250/pk
EUR 359
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock
T4 (Thyroxine) ELISA test
16 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of T4 (Thyroxine)
Human Protocadherin Beta 15 (PCDHb15) Protein
20-abx650578
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Protocadherin Beta 2 (PCDHb2) Protein
20-abx068787
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
PCDHB16 siRNA
20-abx927902
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PCDHB16 antibody
70R-8821 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PCDHB16 antibody
PCDHB16 Antibody
35994-100ul 100ul
EUR 252
PCDHB16 Antibody
1-CSB-PA889094LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCDHB16. Recognizes PCDHB16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
PCDHB16 Antibody
1-CSB-PA447170
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PCDHB16. Recognizes PCDHB16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
anti-PCDHB16
YF-PA20275 50 ul
EUR 363
Description: Mouse polyclonal to PCDHB16
Human Protocadherin 1 ELISA kit
E01P0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Protocadherin 1 ELISA kit
E01P0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Protocadherin 1 ELISA kit
E01P0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Protocadherin Beta 12 (PCDHB12) Antibody
20-abx114899
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protocadherin Beta 15 (PCDHB15) Antibody
20-abx114900
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protocadherin Beta 5 (PCDHB5) Antibody
20-abx114901
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protocadherin Beta 15 (PCDHb15) Antibody
20-abx130459
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Protocadherin Beta 2 (PCDHb2) Antibody
20-abx102292
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Protocadherin Beta 2 (PCDHb2) Antibody
20-abx102293
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Protocadherin Beta-10 (PCDHB10) Antibody
abx036734-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Protocadherin Beta-4 (PCDHB4) Antibody
abx037088-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Protocadherin Beta-7 (PCDHB7) Antibody
abx037312-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Protocadherin Beta 11 (PCDHB11) Antibody
abx038114-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Protocadherin Beta-10 (PCDHB10) Antibody
abx026395-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Protocadherin Beta-10 (PCDHB10) Antibody
abx026395-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Protocadherin Beta 15 (PCDHB15) Antibody
abx026558-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Protocadherin Beta 15 (PCDHB15) Antibody
abx026558-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Protocadherin Beta-3 (PCDHB3) Antibody
abx026623-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Protocadherin Beta-3 (PCDHB3) Antibody
abx026623-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Protocadherin Beta-14 (PCDHB14) Antibody
abx026728-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Protocadherin Beta-14 (PCDHB14) Antibody
abx026728-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Protocadherin Beta 12 (PCDHB12) Antibody
abx026734-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Protocadherin Beta 12 (PCDHB12) Antibody
abx026734-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Protocadherin Beta 5 (PCDHB5) Antibody
abx027291-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Protocadherin Beta 5 (PCDHB5) Antibody
abx027291-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Protocadherin Beta-1 (PCDHB1) Antibody
abx028054-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Protocadherin Beta-1 (PCDHB1) Antibody
abx028054-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Protocadherin Beta 15 (PCDHb15) Antibody
20-abx174303
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Protocadherin Beta 12 (PCDHB12) Antibody
abx236202-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Protocadherin Beta 5 (PCDHB5) Antibody
abx236203-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Protocadherin Beta 5 (PCDHB5) Antibody
abx236204-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Protocadherin Beta 11 (PCDHB11) Antibody
20-abx211032
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protocadherin Beta 15 (PCDHB15) Antibody
20-abx211033
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protocadherin Beta 15 (PCDHB15) Antibody
20-abx211034
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Protocadherin Beta 7 (PCDHb7)
4-RPE067Ra01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: M0R4V1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.5kDa
  • Isoelectric Point: 4.2
Description: Recombinant Rat Protocadherin Beta 7 expressed in: E.coli
Recombinant Protocadherin Beta 8 (PCDHb8)
4-RPE068Mu01
  • EUR 592.80
  • EUR 262.00
  • EUR 1948.00
  • EUR 716.00
  • EUR 1332.00
  • EUR 460.00
  • EUR 4720.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: A8E4K6
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.4kDa
  • Isoelectric Point: 4.6
Description: Recombinant Mouse Protocadherin Beta 8 expressed in: E.coli
Recombinant Protocadherin Beta 9 (PCDHb9)
4-RPE069Hu01
  • EUR 592.80
  • EUR 262.00
  • EUR 1948.00
  • EUR 716.00
  • EUR 1332.00
  • EUR 460.00
  • EUR 4720.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y5E1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.7kDa
  • Isoelectric Point: 4.9
Description: Recombinant Human Protocadherin Beta 9 expressed in: E.coli
Recombinant Protocadherin Beta 14 (PCDHb14)
4-RPE074Mu01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6PB90
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.5kDa
  • Isoelectric Point: 5.3
Description: Recombinant Mouse Protocadherin Beta 14 expressed in: E.coli
Recombinant Protocadherin Beta 15 (PCDHb15)
4-RPE075Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y5E8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Protocadherin Beta 15 expressed in: E.coli
Recombinant Protocadherin Beta 2 (PCDHb2)
4-RPB401Hu01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y5E7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.3kDa
  • Isoelectric Point: 5
Description: Recombinant Human Protocadherin Beta 2 expressed in: E.coli
Recombinant Protocadherin Beta 2 (PCDHb2)
4-RPB401Mu01
  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q91Y00
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.5kDa
  • Isoelectric Point: 5.3
Description: Recombinant Mouse Protocadherin Beta 2 expressed in: E.coli
Anti-Protocadherin beta 12 (1D11)
YF-MA18928 100 ug
EUR 363
Description: Mouse monoclonal to Protocadherin beta 12
Anti-protocadherin beta 10 (4C4)
YF-MA18930 100 ug
EUR 363
Description: Mouse monoclonal to protocadherin beta 10
Anti-Protocadherin beta 3 (4F6)
YF-MA18932 100 ug
EUR 363
Description: Mouse monoclonal to Protocadherin beta 3
0.2-2UL ADJUSTABLE VOLUME 16 CHANNEL AXYPET PIPETTOR
AP-16-2 1/pk
EUR 625
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
5-50UL ADJUSTABLE VOLUME 16 CHANNEL AXYPET PIPETTOR
AP-16-50 1/pk
EUR 625
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Human PCDHB16 shRNA Plasmid
20-abx961656
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PCDHB16 Recombinant Protein (Human)
RP022702 100 ug Ask for price
Protocadherin Beta 2 (PCDHb2) Polyclonal Antibody (Human)
4-PAB401Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDHb2 (Leu54~Arg291)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 2 (PCDHb2)
Human IL-16(Interleukin 16) ELISA Kit
EH0178 96T
EUR 476.25
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: Q14005
  • Alias: IL-16(Interleukin 16)/IL16/LCF/NIL16/PRIL16/prIL-16
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml
Human Interleukin 16(IL-16)ELISA Kit
GA-E0136HM-48T 48T
EUR 289
Human Interleukin 16(IL-16)ELISA Kit
GA-E0136HM-96T 96T
EUR 466
Human Syntaxin 16 (Syntaxin 16) ELISA Kit
abx259866-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Interleukin 16,IL-16 ELISA KIT
201-12-0097 96 tests
EUR 440
  • This Interleukin 16 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Interleukin 16, IL-16 ELISA KIT
CSB-E04605h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 16, IL-16 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Interleukin 16, IL-16 ELISA KIT
1-CSB-E04605h
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 16, IL-16 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Interleukin 16,IL-16 ELISA KIT
CN-03215H1 96T
EUR 434
Human Interleukin 16,IL-16 ELISA KIT
CN-03215H2 48T
EUR 284
Human Interleukin-16 (IL-16) ELISA Kit
LF-EK60020 1×96T
EUR 790
Human Interleukin 16(IL-16)ELISA Kit
QY-E04324 96T
EUR 361
beta- Amyloid (1-16)
5-00419 4 x 1mg Ask for price
beta-Amyloid (16-20)
5-00440 4 x 5mg Ask for price
beta- Amyloid (16-23)
5-00441 4 x 5mg Ask for price
beta-Amyloid (16-26)
5-00442 4 x 5mg Ask for price
beta - Amyloid (30 - 16)
5-00450 4 x 1mg Ask for price
PCDHB16 Conjugated Antibody
C35994 100ul
EUR 397
PCDHB16 Rabbit pAb
A15493-100ul 100 ul
EUR 308
PCDHB16 Rabbit pAb
A15493-200ul 200 ul
EUR 459
PCDHB16 Rabbit pAb
A15493-20ul 20 ul
EUR 183
PCDHB16 Rabbit pAb
A15493-50ul 50 ul
EUR 223
PCDHB16 Blocking Peptide
33R-4089 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PCDHB16 antibody, catalog no. 70R-8821
PCDHB16 cloning plasmid
CSB-CL889094HU-10ug 10ug
EUR 762
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2331
  • Sequence: atggagattggatggatgcacaatcggagacaaaggcaagtccttgttttctttgttttgctgagcttgtctggggcgggcgccgagttggggtcctattccgtagtggaagaaacggagagaggctcttttgtggcaaatctaggaaaagacctggggttggggttgacagaga
  • Show more
Description: A cloning plasmid for the PCDHB16 gene.

Human PCDHb16(Protocadherin Beta 16) ELISA Kit