Tandem neopentyl glycol maltosides (TNMs) for membrane protein stabilisation.

A novel class of detergents, designated tandem neopentyl glycol maltosides (TNMs), were evaluated with four target membrane proteins.

Mouse Actin Beta (ACTb) ELISA Kit

DLR-ACTb-Mu-48T 48T
EUR 508
  • Should the Mouse Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Actin Beta (ACTb) ELISA Kit

DLR-ACTb-Mu-96T 96T
EUR 661
  • Should the Mouse Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Actin Beta (ACTb) ELISA Kit

DLR-ACTb-Ra-48T 48T
EUR 528
  • Should the Rat Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Actin Beta (ACTb) ELISA Kit

DLR-ACTb-Ra-96T 96T
EUR 690
  • Should the Rat Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Actin Beta (ACTb) ELISA Kit

RD-ACTb-Hu-48Tests 48 Tests
EUR 500

Human Actin Beta (ACTb) ELISA Kit

RD-ACTb-Hu-96Tests 96 Tests
EUR 692

Mouse Actin Beta (ACTb) ELISA Kit

RD-ACTb-Mu-48Tests 48 Tests
EUR 511

Mouse Actin Beta (ACTb) ELISA Kit

RD-ACTb-Mu-96Tests 96 Tests
EUR 709

Rat Actin Beta (ACTb) ELISA Kit

RD-ACTb-Ra-48Tests 48 Tests
EUR 534

Rat Actin Beta (ACTb) ELISA Kit

RD-ACTb-Ra-96Tests 96 Tests
EUR 742

Human Actin Beta (ACTb) ELISA Kit

RDR-ACTb-Hu-48Tests 48 Tests
EUR 522

Human Actin Beta (ACTb) ELISA Kit

RDR-ACTb-Hu-96Tests 96 Tests
EUR 724

Mouse Actin Beta (ACTb) ELISA Kit

RDR-ACTb-Mu-48Tests 48 Tests
EUR 534

Mouse Actin Beta (ACTb) ELISA Kit

RDR-ACTb-Mu-96Tests 96 Tests
EUR 742

Rat Actin Beta (ACTb) ELISA Kit

RDR-ACTb-Ra-48Tests 48 Tests
EUR 558

Rat Actin Beta (ACTb) ELISA Kit

RDR-ACTb-Ra-96Tests 96 Tests
EUR 776

Actb/ Rat Actb ELISA Kit

ELI-34919r 96 Tests
EUR 886

ACTB antibody

70R-15285 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody

ACTB antibody

70R-15472 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody

ACTB antibody

70R-15561 50 ul
EUR 435
Description: Rabbit polyclonal ACTB antibody

ACTB Antibody

35532-100ul 100ul
EUR 252

ACTB antibody

10R-10271 100 ug
EUR 435
Description: Mouse monoclonal ACTB antibody

ACTB antibody

10R-10272 100 ug
EUR 435
Description: Mouse monoclonal ACTB antibody

ACTB antibody

10R-1242 100 ug
EUR 512
Description: Mouse monoclonal ACTB antibody

ACTB Antibody

1-CSB-PA000813
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/1000-1/4000.IHC:1/100-1/300.ELISA:1/20000

ACTB Antibody

1-CSB-PA001207GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

ACTB Antibody

1-CSB-PA001207NJ01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

ACTB Antibody

1-CSB-PA000350
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, X. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:3000IHC:1:200

Actb Antibody

1-CSB-PA07675A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Actb. Recognizes Actb from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

ACTB-1003

B2016-25
EUR 805

ACTB-1003

B2016-5
EUR 240

ACTB-1003

B4904-10 10 mg
EUR 601

ACTB-1003

B4904-100 100 mg
EUR 2364

ACTB-1003

B4904-5 5 mg
EUR 435

ACTB-1003

B4904-50 50 mg
EUR 1703

ACTB Antibody

CSB-PA551635-
EUR 335
  • Form: liquid
  • Buffer: Purified Rabbit polyclonal in PBS(pH 7.4) containing with 0.02% sodium azide and 50% glycerol. Affinity purification
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

ACTB Antibody

CSB-PA551635-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Purified Rabbit polyclonal in PBS(pH 7.4) containing with 0.02% sodium azide and 50% glycerol. Affinity purification
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

ACTB Antibody

CSB-PA284599-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

ACTB Antibody

CSB-PA284599-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

ACTB Antibody

1-CSB-PA01629A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:100-1:500, IF:1:50-1:200

ACTB Antibody

1-CSB-PA244513
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:500-1:2000

ACTB siRNA

20-abx900145
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ACTB siRNA

20-abx906619
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ACTB siRNA

20-abx906620
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ACTB-1003

HY-16025 2mg
EUR 243

pET28a-ACTB

PVT14609 2 ug
EUR 495

pOTB7-ACTB

PVT18471 2 ug
EUR 231

ACTB antibody (biotin)

60R-1690 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody (biotin)

ACTB antibody (FITC)

60R-1691 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody (FITC)

ACTB antibody (HRP)

60R-1692 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody (HRP)

ACTB antibody (HRP)

60R-2233 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody (HRP)

ACTB antibody (FITC)

60R-2234 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody (FITC)

ACTB antibody (biotin)

60R-2235 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody (biotin)

Polyclonal ACTB Antibody

APR03421G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB . This antibody is tested and proven to work in the following applications:

ACTB Mouse mAb

AC004 50 ul
EUR 176

ACTB Rabbit pAb

AC006 50 ul
EUR 176

ACTB Rabbit mAb

AC026 50 ul
EUR 204

ACTB Rabbit mAb

AC038 50 ul
EUR 176

ACTB Conjugated Antibody

C35532 100ul
EUR 397

ACTB cloning plasmid

CSB-CL001207HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atgtgcaaggccggcttcgcgggcgacgatgccccccgggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatggtgggcatgggtcagaaggattcctatgtgggcgacgaggcccagagcaagagaggcatcctcaccctgaagtaccccatcgagcacg
  • Show more
Description: A cloning plasmid for the ACTB gene.

ACTB cloning plasmid

CSB-CL001207HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1128
  • Sequence: atggatgatgatatcgccgcgctcgtcgtcgacaacggctccggcatgtgcaaggccggcttcgcgggcgacgatgccccccgggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatggtgggcatgggtcagaaggattcctatgtgggcgacgaggccc
  • Show more
Description: A cloning plasmid for the ACTB gene.

ACTB cloning plasmid

CSB-CL001207HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1128
  • Sequence: atggatgatgatatcgccgcgctcgtcgtcgacaacggctccggcatgtgcaaggccggcttcgcgggcgacgatgccccccgggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatggtgggcatgggtcagaaggattcctatgtgggcgacgaggccc
  • Show more
Description: A cloning plasmid for the ACTB gene.

ACTB Polyclonal Antibody

A52074 100 µg
EUR 570.55
Description: Ask the seller for details

Actb Polyclonal Antibody

A53186 100 µg
EUR 570.55
Description: The best epigenetics products

ACTB Polyclonal Antibody

ABP57696-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ACTB protein
  • Applications tips:
Description: A polyclonal antibody for detection of ACTB from Human, Mouse, Rat. This ACTB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTB protein

ACTB Polyclonal Antibody

ABP57696-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ACTB protein
  • Applications tips:
Description: A polyclonal antibody for detection of ACTB from Human, Mouse, Rat. This ACTB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTB protein

ACTB Polyclonal Antibody

ABP57696-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ACTB protein
  • Applications tips:
Description: A polyclonal antibody for detection of ACTB from Human, Mouse, Rat. This ACTB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTB protein

ACTB Polyclonal Antibody

ES10848-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ACTB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ACTB Polyclonal Antibody

ES10848-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ACTB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SEAP (ActB, Puro)

LVP1221 1x107 IFU/ml x 200ul
EUR 349
Description: Lentivirus express SEAP under ActB promoter, containing puromycin selection.

pCMV-SPORT6-ACTB

PVT12614 2 ug
EUR 391

Anti-ACTB antibody

STJ113532 100 µl
EUR 280
Description: This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, and integrity. This actin is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins.

Anti-ACTB antibody

STJ116402 100 µl
EUR 277
Description: This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, and integrity. This actin is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins.

Anti-ACTB Antibody

STJ500039 100 µg
EUR 515

Anti-ACTB Antibody

STJ500042 100 µg
EUR 476

Anti-ACTB antibody

STJ192006 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ACTB

ACTB/POTEKP/ACTG1 Antibody

1-CSB-PA000809
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACTB/POTEKP/ACTG1. Recognizes ACTB/POTEKP/ACTG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Actb Antibody, HRP conjugated

1-CSB-PA07675B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Actb. Recognizes Actb from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Actb Antibody, FITC conjugated

1-CSB-PA07675C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Actb. Recognizes Actb from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Actb Antibody, Biotin conjugated

1-CSB-PA07675D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Actb. Recognizes Actb from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

ACTB Antibody, HRP conjugated

1-CSB-PA01629B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ACTB Antibody, FITC conjugated

1-CSB-PA01629C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ACTB Antibody, Biotin conjugated

1-CSB-PA01629D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Beta Actin (ACTB) Antibody

20-abx009628
  • EUR 258.00
  • EUR 356.00
  • EUR 175.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx010349-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx010457-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx025152-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx025189-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx025190-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx025190-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx025616-400ul 400 ul
EUR 551
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx025616-80l 80 µl
EUR 321
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx005571
  • EUR 314.00
  • EUR 411.00
  • EUR 258.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx005572
  • EUR 314.00
  • EUR 411.00
  • EUR 258.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx018070-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx018071-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx018342-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx019022-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx019023-100ug 100 ug
EUR 356
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx019024
  • EUR 321.00
  • EUR 119.00
  • 100 ug
  • 10 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx210097
  • EUR 328.00
  • EUR 272.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx110772
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx118009
  • EUR 551.00
  • EUR 481.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx037900-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx037901-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx129303
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Beta Actin (ACTB) Antibody

20-abx132139
  • EUR 328.00
  • EUR 84.00
  • EUR 746.00
  • EUR 439.00
  • EUR 112.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • Shipped within 5-7 working days.

Beta Actin (ACTB) Antibody

20-abx132249
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Beta Actin (ACTB) Antibody

20-abx133823
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx133824
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx133825
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx133826
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx133827
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx133829
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx133830
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx109486
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx109487
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx109488
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Protein

20-abx166379
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Actin Beta (ACTB) Antibody

20-abx159309
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

20-abx159310
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

20-abx159311
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

20-abx159312
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

abx159313-100ul 100 ul
EUR 356
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

20-abx159314
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

20-abx159315
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

abx159316-100ul 100 ul
EUR 356
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

abx159317-100ul 100 ul
EUR 356
  • Shipped within 5-10 working days.

Actin (ACTB / ACTC) Antibody

abx028417-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Actin (ACTB / ACTC) Antibody

abx028417-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

20-abx249494
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx241125
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human ACTb ELISA Kit

EHA0406 96Tests
EUR 521

Goat ACTb ELISA Kit

EGTA0406 96Tests
EUR 521

Actin, cytoplasmic 1/ACTB

E21-E15 10ug
EUR 343

Canine ACTb ELISA Kit

ECA0406 96Tests
EUR 521

Chicken ACTb ELISA Kit

ECKA0406 96Tests
EUR 521

Anserini ACTb ELISA Kit

EAA0406 96Tests
EUR 521

Bovine ACTb ELISA Kit

EBA0406 96Tests
EUR 521

Canine ACTB ELISA KIT

ELI-24817d 96 Tests
EUR 928

The best detergent varied depending on the target, but TNM-C12L and TNM-C11S were notable for their ability to confer increased membrane protein stability compared to DDM. These agents have potential for use in membrane protein research.