Tandem neopentyl glycol maltosides (TNMs) for membrane protein stabilisation.

A novel class of detergents, designated tandem neopentyl glycol maltosides (TNMs), were evaluated with four target membrane proteins.

Mouse Actin Beta (ACTb) ELISA Kit
DLR-ACTb-Mu-48T	DL Develop	48T	EUR 508
Should the Mouse Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Actin Beta (ACTb) ELISA Kit
DLR-ACTb-Mu-96T	DL Develop	96T	EUR 661
Should the Mouse Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Actin Beta (ACTb) ELISA Kit
DLR-ACTb-Ra-48T	DL Develop	48T	EUR 528
Should the Rat Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Actin Beta (ACTb) ELISA Kit
DLR-ACTb-Ra-96T	DL Develop	96T	EUR 690
Should the Rat Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Actin Beta (ACTb) ELISA Kit
RD-ACTb-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Actin Beta (ACTb) ELISA Kit
RD-ACTb-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Actin Beta (ACTb) ELISA Kit
RD-ACTb-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Actin Beta (ACTb) ELISA Kit
RD-ACTb-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Actin Beta (ACTb) ELISA Kit
RD-ACTb-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Actin Beta (ACTb) ELISA Kit
RD-ACTb-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Human Actin Beta (ACTb) ELISA Kit
RDR-ACTb-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Actin Beta (ACTb) ELISA Kit
RDR-ACTb-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Mouse Actin Beta (ACTb) ELISA Kit
RDR-ACTb-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534

Mouse Actin Beta (ACTb) ELISA Kit
RDR-ACTb-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742

Rat Actin Beta (ACTb) ELISA Kit
RDR-ACTb-Ra-48Tests	Reddot Biotech	48 Tests	EUR 558

Rat Actin Beta (ACTb) ELISA Kit
RDR-ACTb-Ra-96Tests	Reddot Biotech	96 Tests	EUR 776

Actb/ Rat Actb ELISA Kit
ELI-34919r	Lifescience Market	96 Tests	EUR 886

ACTB antibody
70R-15285	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ACTB antibody

ACTB antibody
70R-15472	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ACTB antibody

ACTB antibody
70R-15561	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ACTB antibody

ACTB Antibody
35532-100ul	SAB	100ul	EUR 252

ACTB antibody
10R-10271	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal ACTB antibody

ACTB antibody
10R-10272	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal ACTB antibody

ACTB antibody
10R-1242	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal ACTB antibody

ACTB Antibody
1-CSB-PA000813	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/1000-1/4000.IHC:1/100-1/300.ELISA:1/20000

ACTB Antibody
1-CSB-PA001207GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

ACTB Antibody
1-CSB-PA001207NJ01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

ACTB Antibody
1-CSB-PA000350	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, X. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:3000IHC:1:200

Actb Antibody
1-CSB-PA07675A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Actb. Recognizes Actb from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

ACTB-1003
B2016-25	Biovision		EUR 805

ACTB-1003
B2016-5	Biovision		EUR 240

ACTB-1003
B4904-10	ApexBio	10 mg	EUR 601

ACTB-1003
B4904-100	ApexBio	100 mg	EUR 2364

ACTB-1003
B4904-5	ApexBio	5 mg	EUR 435

ACTB-1003
B4904-50	ApexBio	50 mg	EUR 1703

ACTB Antibody
CSB-PA551635-	Cusabio		EUR 335
Form: liquid Buffer: Purified Rabbit polyclonal in PBS(pH 7.4) containing with 0.02% sodium azide and 50% glycerol. Affinity purification
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

ACTB Antibody
CSB-PA551635-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Purified Rabbit polyclonal in PBS(pH 7.4) containing with 0.02% sodium azide and 50% glycerol. Affinity purification
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

ACTB Antibody
CSB-PA284599-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

ACTB Antibody
CSB-PA284599-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

ACTB Antibody
1-CSB-PA01629A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:100-1:500, IF:1:50-1:200

ACTB Antibody
1-CSB-PA244513	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:500-1:2000

ACTB siRNA
20-abx900145	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ACTB siRNA
20-abx906619	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ACTB siRNA
20-abx906620	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ACTB-1003
HY-16025	MedChemExpress	2mg	EUR 243

pET28a-ACTB
PVT14609	Lifescience Market	2 ug	EUR 495

pOTB7-ACTB
PVT18471	Lifescience Market	2 ug	EUR 231

ACTB antibody (biotin)
60R-1690	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ACTB antibody (biotin)

ACTB antibody (FITC)
60R-1691	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ACTB antibody (FITC)

ACTB antibody (HRP)
60R-1692	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ACTB antibody (HRP)

ACTB antibody (HRP)
60R-2233	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ACTB antibody (HRP)

ACTB antibody (FITC)
60R-2234	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ACTB antibody (FITC)

ACTB antibody (biotin)
60R-2235	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ACTB antibody (biotin)

Polyclonal ACTB Antibody
APR03421G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB . This antibody is tested and proven to work in the following applications:

ACTB Mouse mAb
AC004	Abclonal	50 ul	EUR 176

ACTB Rabbit pAb
AC006	Abclonal	50 ul	EUR 176

ACTB Rabbit mAb
AC026	Abclonal	50 ul	EUR 204

ACTB Rabbit mAb
AC038	Abclonal	50 ul	EUR 176

ACTB Conjugated Antibody
C35532	SAB	100ul	EUR 397

ACTB cloning plasmid
CSB-CL001207HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1083 Sequence: atgtgcaaggccggcttcgcgggcgacgatgccccccgggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatggtgggcatgggtcagaaggattcctatgtgggcgacgaggcccagagcaagagaggcatcctcaccctgaagtaccccatcgagcacg Show more
Description: A cloning plasmid for the ACTB gene.

ACTB cloning plasmid
CSB-CL001207HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1128 Sequence: atggatgatgatatcgccgcgctcgtcgtcgacaacggctccggcatgtgcaaggccggcttcgcgggcgacgatgccccccgggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatggtgggcatgggtcagaaggattcctatgtgggcgacgaggccc Show more
Description: A cloning plasmid for the ACTB gene.

ACTB cloning plasmid
CSB-CL001207HU3-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1128 Sequence: atggatgatgatatcgccgcgctcgtcgtcgacaacggctccggcatgtgcaaggccggcttcgcgggcgacgatgccccccgggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatggtgggcatgggtcagaaggattcctatgtgggcgacgaggccc Show more
Description: A cloning plasmid for the ACTB gene.

ACTB Polyclonal Antibody
A52074	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Actb Polyclonal Antibody
A53186	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

ACTB Polyclonal Antibody
ABP57696-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human ACTB protein Applications tips:
Description: A polyclonal antibody for detection of ACTB from Human, Mouse, Rat. This ACTB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTB protein

ACTB Polyclonal Antibody
ABP57696-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human ACTB protein Applications tips:
Description: A polyclonal antibody for detection of ACTB from Human, Mouse, Rat. This ACTB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTB protein

ACTB Polyclonal Antibody
ABP57696-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ACTB protein Applications tips:
Description: A polyclonal antibody for detection of ACTB from Human, Mouse, Rat. This ACTB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTB protein

ACTB Polyclonal Antibody
ES10848-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ACTB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ACTB Polyclonal Antibody
ES10848-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ACTB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SEAP (ActB, Puro)
LVP1221	GenTarget	1x107 IFU/ml x 200ul	EUR 349
Description: Lentivirus express SEAP under ActB promoter, containing puromycin selection.

pCMV-SPORT6-ACTB
PVT12614	Lifescience Market	2 ug	EUR 391

Anti-ACTB antibody
STJ113532	St John's Laboratory	100 µl	EUR 280
Description: This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, and integrity. This actin is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins.

Anti-ACTB antibody
STJ116402	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, and integrity. This actin is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins.

Anti-ACTB Antibody
STJ500039	St John's Laboratory	100 µg	EUR 515

Anti-ACTB Antibody
STJ500042	St John's Laboratory	100 µg	EUR 476

Anti-ACTB antibody
STJ192006	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ACTB

ACTB/POTEKP/ACTG1 Antibody
1-CSB-PA000809	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACTB/POTEKP/ACTG1. Recognizes ACTB/POTEKP/ACTG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Actb Antibody, HRP conjugated
1-CSB-PA07675B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Actb. Recognizes Actb from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Actb Antibody, FITC conjugated
1-CSB-PA07675C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Actb. Recognizes Actb from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Actb Antibody, Biotin conjugated
1-CSB-PA07675D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Actb. Recognizes Actb from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

ACTB Antibody, HRP conjugated
1-CSB-PA01629B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ACTB Antibody, FITC conjugated
1-CSB-PA01629C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ACTB Antibody, Biotin conjugated
1-CSB-PA01629D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Beta Actin (ACTB) Antibody
20-abx009628	Abbexa	EUR 258.00 EUR 356.00 EUR 175.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx010349-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx010457-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx025152-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx025189-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx025190-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx025190-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx025616-400ul	Abbexa	400 ul	EUR 551
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx025616-80l	Abbexa	80 µl	EUR 321
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx005571	Abbexa	EUR 314.00 EUR 411.00 EUR 258.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx005572	Abbexa	EUR 314.00 EUR 411.00 EUR 258.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx018070-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx018071-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx018342-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx019022-100ug	Abbexa	100 ug	EUR 342
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx019023-100ug	Abbexa	100 ug	EUR 356
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx019024	Abbexa	EUR 321.00 EUR 119.00	100 ug 10 ug
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx210097	Abbexa	EUR 328.00 EUR 272.00	100 ug 50 ug
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx110772	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx118009	Abbexa	EUR 551.00 EUR 481.00	100 ul 50 ul
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx037900-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
abx037901-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx129303	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Beta Actin (ACTB) Antibody
20-abx132139	Abbexa	EUR 328.00 EUR 84.00 EUR 746.00 EUR 439.00 EUR 112.00	100 ug 10 ug 1 mg 200 ug 20 ug
Shipped within 5-7 working days.

Beta Actin (ACTB) Antibody
20-abx132249	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Beta Actin (ACTB) Antibody
20-abx133823	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx133824	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx133825	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx133826	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx133827	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx133829	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx133830	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx109486	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx109487	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx109488	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Beta Actin (ACTB) Protein
20-abx166379	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Actin Beta (ACTB) Antibody
20-abx159309	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody
20-abx159310	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody
20-abx159311	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody
20-abx159312	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody
abx159313-100ul	Abbexa	100 ul	EUR 356
Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody
20-abx159314	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody
20-abx159315	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody
abx159316-100ul	Abbexa	100 ul	EUR 356
Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody
abx159317-100ul	Abbexa	100 ul	EUR 356
Shipped within 5-10 working days.

Actin (ACTB / ACTC) Antibody
abx028417-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Actin (ACTB / ACTC) Antibody
abx028417-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody
20-abx249494	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody
20-abx241125	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Human ACTb ELISA Kit
EHA0406	Abclonal	96Tests	EUR 521

Goat ACTb ELISA Kit
EGTA0406	Abclonal	96Tests	EUR 521

Actin, cytoplasmic 1/ACTB
E21-E15	EnoGene	10ug	EUR 343

Canine ACTb ELISA Kit
ECA0406	Abclonal	96Tests	EUR 521

Chicken ACTb ELISA Kit
ECKA0406	Abclonal	96Tests	EUR 521

Anserini ACTb ELISA Kit
EAA0406	Abclonal	96Tests	EUR 521

Bovine ACTb ELISA Kit
EBA0406	Abclonal	96Tests	EUR 521

Canine ACTB ELISA KIT
ELI-24817d	Lifescience Market	96 Tests	EUR 928

The best detergent varied depending on the target, but TNM-C12L and TNM-C11S were notable for their ability to confer increased membrane protein stability compared to DDM. These agents have potential for use in membrane protein research.