Human AHNAK(Desmoyokin) ELISA Kit

Human AHNAK(Desmoyokin) ELISA Kit

To Order: Contact us

Human Desmoyokin (AHNAK) ELISA Kit

RD-AHNAK-Hu-48Tests 48 Tests
EUR 521

Human Desmoyokin (AHNAK) ELISA Kit

RD-AHNAK-Hu-96Tests 96 Tests
EUR 723

Human Desmoyokin (AHNAK) ELISA Kit

RDR-AHNAK-Hu-48Tests 48 Tests
EUR 544

Human Desmoyokin (AHNAK) ELISA Kit

RDR-AHNAK-Hu-96Tests 96 Tests
EUR 756

Human Desmoyokin (AHNAK) ELISA Kit

abx572439-96tests 96 tests
EUR 848
  • Shipped within 5-12 working days.

Human Desmoyokin (AHNAK) ELISA Kit

20-abx151304
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Desmoyokin (AHNAK)ELISA Kit

201-12-2651 96 tests
EUR 440
  • This Desmoyokin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Desmoyokin ELISA Kit (AHNAK)

RK00851 96 Tests
EUR 521

Human Desmoyokin(AHNAK)ELISA Kit

QY-E01879 96T
EUR 361

Human Desmoyokin (AHNAK) ELISA Kit

SEJ661Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Desmoyokin (AHNAK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Desmoyokin (AHNAK) in tissue homogenates, cell lysates and other biological fluids.

Human Desmoyokin (AHNAK) ELISA Kit

SEJ661Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Desmoyokin (AHNAK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Desmoyokin (AHNAK) in tissue homogenates, cell lysates and other biological fluids.

Human Desmoyokin (AHNAK) ELISA Kit

SEJ661Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Desmoyokin (AHNAK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Desmoyokin (AHNAK) in tissue homogenates, cell lysates and other biological fluids.

Human Desmoyokin (AHNAK) ELISA Kit

SEJ661Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Desmoyokin (AHNAK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Desmoyokin (AHNAK) in tissue homogenates, cell lysates and other biological fluids.

Human Desmoyokin (AHNAK) ELISA Kit

4-SEJ661Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Desmoyokin elisa. Alternative names of the recognized antigen: AHNAKRS
  • AHNAK Nucleoprotein
  • Neuroblast differentiation-associated protein AHNAK
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Desmoyokin (AHNAK) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Desmoyokin (AHNAK) Antibody

20-abx129177
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Desmoyokin (AHNAK) Antibody

20-abx172102
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Desmoyokin (AHNAK) Antibody

20-abx333726
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Desmoyokin (AHNAK) Antibody

abx230230-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Desmoyokin (AHNAK)

4-RPJ661Hu01
  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q09666
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Desmoyokin expressed in: E.coli

ELISA kit for Human AHNAK (Desmoyokin)

ELK3322 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Desmoyokin (AHNAK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Desmoyokin (AHN
  • Show more
Description: A sandwich ELISA kit for detection of Desmoyokin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Desmoyokin (AHNAK) Protein

20-abx166829
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Desmoyokin (AHNAK) CLIA Kit

20-abx495757
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Desmoyokin (AHNAK) Antibody (HRP)

20-abx336745
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Desmoyokin (AHNAK) Antibody (FITC)

20-abx336746
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Desmoyokin (AHNAK) Antibody (Biotin)

20-abx336747
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Desmoyokin (AHNAK) Polyclonal Antibody (Human)

4-PAJ661Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHNAK (Met1~Asp300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK)

Desmoyokin (AHNAK) Polyclonal Antibody (Human), APC

4-PAJ661Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHNAK (Met1~Asp300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK). This antibody is labeled with APC.

Desmoyokin (AHNAK) Polyclonal Antibody (Human), Biotinylated

4-PAJ661Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHNAK (Met1~Asp300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK). This antibody is labeled with Biotin.

Desmoyokin (AHNAK) Polyclonal Antibody (Human), Cy3

4-PAJ661Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHNAK (Met1~Asp300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK). This antibody is labeled with Cy3.

Desmoyokin (AHNAK) Polyclonal Antibody (Human), FITC

4-PAJ661Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHNAK (Met1~Asp300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK). This antibody is labeled with FITC.

Desmoyokin (AHNAK) Polyclonal Antibody (Human), HRP

4-PAJ661Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHNAK (Met1~Asp300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK). This antibody is labeled with HRP.

Desmoyokin (AHNAK) Polyclonal Antibody (Human), PE

4-PAJ661Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHNAK (Met1~Asp300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK). This antibody is labeled with PE.

Desmoyokin (AHNAK) Polyclonal Antibody (Human), APC-Cy7

4-PAJ661Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHNAK (Met1~Asp300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK). This antibody is labeled with APC-Cy7.

Human AHNAK ELISA KIT

ELI-11966h 96 Tests
EUR 824

AHNAK ELISA KIT|Human

EF007669 96 Tests
EUR 689

AHNAK ELISA Kit (Human) (OKCD00575)

OKCD00575 96 Wells
EUR 831
Description: Description of target: May be required for neuronal cell differentiation. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

Desmoyokin antibody

20R-2606 100 uL
EUR 571
Description: Guinea Pig polyclonal Desmoyokin antibody

Desmoyokin Antibody

DF10323 200ul
EUR 304
Description: Desmoyokin Antibody detects endogenous levels of Desmoyokin.

Human AHNAK Nucleoprotein 2(AHNAK2)ELISA Kit

QY-E05162 96T
EUR 400

Desmoyokin (pS5782) Antibody

abx148069-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Desmoyokin Blocking Peptide

DF10323-BP 1mg
EUR 195

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

AHNAK siRNA

20-abx907068
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AHNAK Antibody

47439-100ul 100ul
EUR 252

AHNAK antibody

10R-1317 100 ug
EUR 512
Description: Mouse monoclonal AHNAK antibody

AHNAK Antibody

1-CSB-PA600257LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AHNAK. Recognizes AHNAK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:50-1:200

anti-AHNAK

YF-PA20722 50 ul
EUR 363
Description: Mouse polyclonal to AHNAK

anti-AHNAK

YF-PA20723 50 ug
EUR 363
Description: Mouse polyclonal to AHNAK

anti-AHNAK

YF-PA20724 100 ug
EUR 403
Description: Rabbit polyclonal to AHNAK

anti-AHNAK

YF-PA26592 50 ul
EUR 334
Description: Mouse polyclonal to AHNAK

Human AHNAK shRNA Plasmid

20-abx962263
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-Desmoyokin (Ser5782) Antibody

AF8084 200ul
EUR 376
Description: Desmoyokin (Phospho-Ser5782) Antibody detects endogenous levels of Desmoyokin only when phosphorylated at Ser5782.

Desmoyokin (Phospho- Ser5782) Antibody

ABF8084 100 ug
EUR 438

Desmoyokin (Phospho-Ser5782) Antibody

12452-100ul 100ul
EUR 252

Desmoyokin (Phospho-Ser5782) Antibody

12452-50ul 50ul
EUR 187

AHNAK Conjugated Antibody

C47439 100ul
EUR 397

AHNAK cloning plasmid

CSB-CL600257HU1-10ug 10ug
EUR 236
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 450
  • Sequence: atggagaaggaggagacaacccgggagctgctgctgcccaactggcagggtagtggctcccacgggctgaccatcgcccagagggacgacggcgtctttgtgcaggaggtgacgcagaactcccctgcggcccgcactggggtggtcaaggagggggaccagattgtgggtgccac
  • Show more
Description: A cloning plasmid for the AHNAK gene.

AHNAK cloning plasmid

CSB-CL600257HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 453
  • Sequence: atggagaaggaggaggagacaacccgggagctgctgctgcccaactggcagggtagtggctcccacgggctgaccatcgcccagagggacgacggcgtctttgtgcaggaggtgacgcagaactcccctgcggcccgcactggggtggtcaaggagggggaccagattgtgggtgc
  • Show more
Description: A cloning plasmid for the AHNAK gene.

anti- AHNAK antibody

FNab00230 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IF: 1:50-1:500
  • Immunogen: AHNAK nucleoprotein
  • Uniprot ID: Q09666
  • Gene ID: 79026
  • Research Area: Developmental biology
Description: Antibody raised against AHNAK

AHNAK Polyclonal Antibody

A68819 100 ?g
EUR 628.55
Description: fast delivery possible

Anti-AHNAK antibody

PAab00230 100 ug
EUR 355

pCMV-SPORT6-AHNAK

PVT12396 2 ug
EUR 391

Anti-AHNAK (3G7)

YF-MA11651 100 ug
EUR 363
Description: Mouse monoclonal to AHNAK

AHNAK ORF Vector (Human) (pORF)

ORF000271 1.0 ug DNA
EUR 95

AHNAK ORF Vector (Human) (pORF)

ORF000272 1.0 ug DNA
EUR 95

Phospho-Desmoyokin (Ser5782) Blocking Peptide

AF8084-BP 1mg
EUR 195

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

AHNAK Antibody, HRP conjugated

1-CSB-PA600257LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AHNAK. Recognizes AHNAK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AHNAK Antibody, FITC conjugated

1-CSB-PA600257LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AHNAK. Recognizes AHNAK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AHNAK Antibody, Biotin conjugated

1-CSB-PA600257LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AHNAK. Recognizes AHNAK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

pECMV-3-FLAG-AHNAK

PVT12974 2 ug
EUR 703

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

AHNAK sgRNA CRISPR Lentivector set (Human)

K0061301 3 x 1.0 ug
EUR 339

Desmoyokin (Phospho-Ser5782) Polyclonal Conjugated Antibody

C12452 100ul
EUR 397

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

AHNAK Nucleoprotein 2 (AHNAK2) Antibody

20-abx334216
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

AHNAK Polyclonal Antibody, HRP Conjugated

A68820 100 ?g
EUR 628.55
Description: reagents widely cited

AHNAK Polyclonal Antibody, FITC Conjugated

A68821 100 ?g
EUR 628.55
Description: Ask the seller for details

AHNAK Polyclonal Antibody, Biotin Conjugated

A68822 100 ?g
EUR 628.55
Description: The best epigenetics products

Ahnak ORF Vector (Mouse) (pORF)

ORF038300 1.0 ug DNA
EUR 506

Ahnak ORF Vector (Mouse) (pORF)

ORF038301 1.0 ug DNA
EUR 6078

Ahnak ORF Vector (Rat) (pORF)

ORF063203 1.0 ug DNA
EUR 5859

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

AHNAK sgRNA CRISPR Lentivector (Human) (Target 1)

K0061302 1.0 ug DNA
EUR 154

AHNAK sgRNA CRISPR Lentivector (Human) (Target 2)

K0061303 1.0 ug DNA
EUR 154

AHNAK sgRNA CRISPR Lentivector (Human) (Target 3)

K0061304 1.0 ug DNA
EUR 154

AHNAK Protein Vector (Human) (pPB-C-His)

PV001081 500 ng
EUR 329

AHNAK Protein Vector (Human) (pPB-N-His)

PV001082 500 ng
EUR 329

AHNAK Protein Vector (Human) (pPM-C-HA)

PV001083 500 ng
EUR 329

AHNAK Protein Vector (Human) (pPM-C-His)

PV001084 500 ng
EUR 329

AHNAK Protein Vector (Human) (pPB-C-His)

PV001085 500 ng
EUR 329

AHNAK Protein Vector (Human) (pPB-N-His)

PV001086 500 ng
EUR 329

AHNAK Protein Vector (Human) (pPM-C-HA)

PV001087 500 ng
EUR 329

AHNAK Protein Vector (Human) (pPM-C-His)

PV001088 500 ng
EUR 329

Recombinant human Neuroblast differentiation-associated protein AHNAK

P2806 100ug Ask for price
  • Uniprot ID: Q09666
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Neuroblast differentiation-associated protein AHNAK

AHNAK Protein Vector (Human) (pPB-His-MBP)

PV320670 500 ng
EUR 329

AHNAK Protein Vector (Human) (pPB-His-GST)

PV320671 500 ng
EUR 329

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AHNAK Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV707235 1.0 ug DNA
EUR 316

AHNAK Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV707239 1.0 ug DNA
EUR 316

AHNAK Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV707240 1.0 ug DNA
EUR 316

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AHNAK Nucleoprotein 2 (AHNAK2) Antibody (HRP)

20-abx337228
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

AHNAK Nucleoprotein 2 (AHNAK2) Antibody (FITC)

20-abx337229
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

AHNAK Nucleoprotein 2 (AHNAK2) Antibody (Biotin)

20-abx337230
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ahnak sgRNA CRISPR Lentivector set (Rat)

K6382701 3 x 1.0 ug
EUR 339

Ahnak sgRNA CRISPR Lentivector set (Mouse)

K3256801 3 x 1.0 ug
EUR 339

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

AHNAK Protein Vector (Human) (pPM-N-D-C-HA)

PV320672 500 ng
EUR 552

AHNAK Protein Vector (Human) (pPM-N-D-C-His)

PV320673 500 ng
EUR 552

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

Monoclonal AHNAK Antibody (monoclonal) (M01), Clone: 3G7

AMM03249G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human AHNAK (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3G7. This antibody is applicable in WB, IP, E

Ahnak sgRNA CRISPR Lentivector (Rat) (Target 1)

K6382702 1.0 ug DNA
EUR 154

Ahnak sgRNA CRISPR Lentivector (Rat) (Target 2)

K6382703 1.0 ug DNA
EUR 154

Ahnak sgRNA CRISPR Lentivector (Rat) (Target 3)

K6382704 1.0 ug DNA
EUR 154

Ahnak sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3256802 1.0 ug DNA
EUR 154

Ahnak sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3256803 1.0 ug DNA
EUR 154

Ahnak sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3256804 1.0 ug DNA
EUR 154

AHNAK Protein Vector (Mouse) (pPB-C-His)

PV153198 500 ng
EUR 603

AHNAK Protein Vector (Mouse) (pPB-N-His)

PV153199 500 ng
EUR 603

AHNAK Protein Vector (Mouse) (pPM-C-HA)

PV153200 500 ng
EUR 603

AHNAK Protein Vector (Mouse) (pPM-C-His)

PV153201 500 ng
EUR 603

AHNAK Protein Vector (Mouse) (pPB-C-His)

PV153202 500 ng
EUR 8865

AHNAK Protein Vector (Mouse) (pPB-N-His)

PV153203 500 ng
EUR 8865

AHNAK Protein Vector (Mouse) (pPM-C-HA)

PV153204 500 ng
EUR 8865

AHNAK Protein Vector (Mouse) (pPM-C-His)

PV153205 500 ng
EUR 8865

AHNAK Protein Vector (Rat) (pPB-C-His)

PV252810 500 ng
EUR 8552

AHNAK Protein Vector (Rat) (pPB-N-His)

PV252811 500 ng
EUR 8552

AHNAK Protein Vector (Rat) (pPM-C-HA)

PV252812 500 ng
EUR 8552

AHNAK Protein Vector (Rat) (pPM-C-His)

PV252813 500 ng
EUR 8552

Ahnak 3'UTR Luciferase Stable Cell Line

TU200419 1.0 ml Ask for price

Ahnak 3'UTR GFP Stable Cell Line

TU151545 1.0 ml Ask for price

AHNAK 3'UTR Luciferase Stable Cell Line

TU000501 1.0 ml
EUR 1394

Ahnak 3'UTR Luciferase Stable Cell Line

TU101545 1.0 ml Ask for price

AHNAK 3'UTR GFP Stable Cell Line

TU050501 1.0 ml
EUR 1394

Ahnak 3'UTR GFP Stable Cell Line

TU250419 1.0 ml Ask for price

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

AHNAK sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0061305 3 x 1.0 ug
EUR 376

AHNAK sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0061306 1.0 ug DNA
EUR 167

AHNAK sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0061307 1.0 ug DNA
EUR 167

AHNAK sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0061308 1.0 ug DNA
EUR 167

AHNAK Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV707236 1.0 ug DNA
EUR 316

AHNAK Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV707237 1.0 ug DNA
EUR 374

AHNAK Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV707238 1.0 ug DNA
EUR 374

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6382705 3 x 1.0 ug
EUR 376

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3256805 3 x 1.0 ug
EUR 376

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6382706 1.0 ug DNA
EUR 167

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6382707 1.0 ug DNA
EUR 167

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6382708 1.0 ug DNA
EUR 167

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3256806 1.0 ug DNA
EUR 167

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3256807 1.0 ug DNA
EUR 167

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3256808 1.0 ug DNA
EUR 167

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit

ELA-E0121h 96 Tests
EUR 824

Human KIT/SCFR ELISA kit

LF-EK50791 1×96T
EUR 648

KIT ELISA Kit (Human) (OKAN04574)

OKAN04574 96 Wells
EUR 792
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

KIT ELISA Kit (Human) (OKCD06003)

OKCD06003 96 Wells
EUR 648
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

Human Biopterin ELISA Kit

CELI-66011h 96 Tests
EUR 824

Human lipopolysaccharides ELISA Kit

CELI-66031h 96 Tests
EUR 824

Human Microlbumin ELISA Kit

abx517025-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Trypsin ELISA kit

E01T0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit

E01T0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit

E01T0139-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit

E01T0140-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AHNAK(Desmoyokin) ELISA Kit