Human CLDN11(Claudin 11) ELISA Kit

Human CLDN11(Claudin 11) ELISA Kit

To Order: Contact us

Human Claudin 11 (CLDN11) ELISA Kit
DLR-CLDN11-Hu-96T	DL Develop	96T	EUR 673
Should the Human Claudin 11 (CLDN11) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 11 (CLDN11) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Claudin 11 (CLDN11) ELISA Kit
RDR-CLDN11-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Claudin 11 (CLDN11) ELISA Kit
RDR-CLDN11-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Claudin 11 (CLDN11) ELISA Kit
RD-CLDN11-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Claudin 11 (CLDN11) ELISA Kit
RD-CLDN11-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Claudin 11 (CLDN11) ELISA Kit
abx595124-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Human Claudin 11 (CLDN11)ELISA kit
201-12-2310	SunredBio	96 tests	EUR 440
This Claudin 11 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 11(CLDN11) ELISA kit
E01C0975-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 11(CLDN11) ELISA kit
E01C0975-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 11(CLDN11) ELISA kit
E01C0975-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 11 (CLDN11) ELISA Kit
20-abx151082	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Claudin 11 (CLDN11) ELISA Kit
abx252220-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human CLDN11(Claudin 11) ELISA Kit
EH2836	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: O75508 Alias: CLDN11/Oligodendrocyte-specific protein/CLDN11/claudin 11/OSP/OTM/Oligodendrocyte-specific protein/OSP/OTM
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Claudin- 11, CLDN11 ELISA KIT
ELI-25920h	Lifescience Market	96 Tests	EUR 824

Human Claudin 11(CLDN11)ELISA Kit
QY-E03563	Qayee Biotechnology	96T	EUR 361

Human Claudin 11 (CLDN11) ELISA Kit
SEF299Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 11 (CLDN11) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 11 (CLDN11) in serum, plasma, tissue homogenates and other biological fluids.

Human Claudin 11 (CLDN11) ELISA Kit
SEF299Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 11 (CLDN11) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 11 (CLDN11) in serum, plasma, tissue homogenates and other biological fluids.

Human Claudin 11 (CLDN11) ELISA Kit
SEF299Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 11 (CLDN11) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 11 (CLDN11) in serum, plasma, tissue homogenates and other biological fluids.

Human Claudin 11 (CLDN11) ELISA Kit
SEF299Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 11 (CLDN11) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 11 (CLDN11) in serum, plasma, tissue homogenates and other biological fluids.

Human Claudin 11 (CLDN11) ELISA Kit
4-SEF299Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Claudin 11 elisa. Alternative names of the recognized antigen: OSP OTM Oligodendrocyte Transmembrane Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Claudin 11 (CLDN11) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Claudin 11 (CLDN11) Antibody
20-abx008904	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Claudin 11 (CLDN11) Antibody
20-abx213728	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Claudin 11 (CLDN11) Antibody
20-abx213825	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Claudin 11 (CLDN11) Antibody
20-abx175879	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Claudin 11 (CLDN11) Antibody
20-abx116806	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Claudin 11 (CLDN11) Antibody
20-abx171760	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Claudin 11 (CLDN11) Antibody
20-abx013040	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Claudin 11 (CLDN11) Antibody
20-abx327147	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Claudin 11 (CLDN11) Antibody
abx231733-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Claudin 11 (CLDN11) Antibody
20-abx002027	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Goat Claudin 11(CLDN11) ELISA kit
E06C0975-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Claudin 11(CLDN11) ELISA kit
E06C0975-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Claudin 11(CLDN11) ELISA kit
E06C0975-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claudin 11(CLDN11) ELISA kit
E03C0975-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claudin 11(CLDN11) ELISA kit
E03C0975-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claudin 11(CLDN11) ELISA kit
E03C0975-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Claudin 11(CLDN11) ELISA kit
E04C0975-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Claudin 11(CLDN11) ELISA kit
E04C0975-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Claudin 11(CLDN11) ELISA kit
E04C0975-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Claudin 11(CLDN11) ELISA kit
E02C0975-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Claudin 11(CLDN11) ELISA kit
E02C0975-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Claudin 11(CLDN11) ELISA kit
E02C0975-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Claudin 11(CLDN11) ELISA kit
E09C0975-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Claudin 11(CLDN11) ELISA kit
E09C0975-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Claudin 11(CLDN11) ELISA kit
E09C0975-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Claudin 11(CLDN11) ELISA kit
E08C0975-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Claudin 11(CLDN11) ELISA kit
E08C0975-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Claudin 11(CLDN11) ELISA kit
E08C0975-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Claudin 11(CLDN11) ELISA kit
E07C0975-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Claudin 11(CLDN11) ELISA kit
E07C0975-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Claudin 11(CLDN11) ELISA kit
E07C0975-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claudin- 11, Cldn11 ELISA KIT
ELI-10365m	Lifescience Market	96 Tests	EUR 865

Bovine Claudin- 11, CLDN11 ELISA KIT
ELI-25255b	Lifescience Market	96 Tests	EUR 928

Monkey Claudin 11 (CLDN11) ELISA Kit
abx359401-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Claudin 11 (CLDN11) ELISA Kit
abx360515-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Claudin 11 (CLDN11) ELISA Kit
abx355662-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Claudin 11 (CLDN11) ELISA Kit
abx363583-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Claudin 11 (CLDN11) Protein
20-abx652935	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ELISA kit for Human CLDN11 (Claudin 11)
E-EL-H0852	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CLDN11 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CLDN11. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CLDN11 (Claudin 11) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human CLDN11 (Claudin 11)
ELK3559	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Claudin 11 (CLDN11). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Claudin 11 (CL Show more
Description: A sandwich ELISA kit for detection of Claudin 11 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Claudin 11 (CLDN11) CLIA Kit
abx196523-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Claudin 11 (CLDN11) CLIA Kit
20-abx494852	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Guinea pig Claudin 11(CLDN11) ELISA kit
E05C0975-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Claudin 11(CLDN11) ELISA kit
E05C0975-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Claudin 11(CLDN11) ELISA kit
E05C0975-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Claudin 11 (CLDN11) ELISA Kit
abx357666-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Claudin 11 (CLDN11) Blocking Peptide
20-abx063037	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

CLIA kit for Human CLDN11 (Claudin 11)
E-CL-H0591	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's CLDN11 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human CLDN11 . Standards or samples are added to the micro CLIA plate wells and combined with Show more
Description: A sandwich CLIA kit for quantitative measurement of Human CLDN11 (Claudin 11) in samples from Serum, Plasma, Cell supernatant

Cldn11/ Rat Cldn11 ELISA Kit
ELI-50978r	Lifescience Market	96 Tests	EUR 886

Claudin 11 antibody
70R-31130	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Claudin 11 antibody

Claudin 11 antibody
70R-50162	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal Claudin 11 antibody

Claudin 11 antibody
70R-6144	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Claudin 11 antibody

Claudin 11 Antibody
AF0750	Affbiotech	200ul	EUR 304
Description: Claudin 11 Antibody detects endogenous levels of Claudin 11.

Claudin 11 Antibody
AF5364	Affbiotech	200ul	EUR 304
Description: Claudin 11 Antibody detects endogenous levels of total Claudin 11.

Claudin 11 Antibody
ABF5364	Lifescience Market	100 ug	EUR 438

Claudin 11 Antibody
ABF0750	Lifescience Market	100 ug	EUR 438

CLDN11 ELISA KIT|Human
EF000282	Lifescience Market	96 Tests	EUR 689

Claudin 11 Colorimetric Cell-Based ELISA Kit
EKC1118	BosterBio	100ul	EUR 572

Claudin 11 Blocking Peptide
33R-9803	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLDN11 antibody, catalog no. 70R-6144

Claudin-11 Polyclonal Antibody
ABP55451-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human Claudin-11 at AA range: 130-210 Applications tips:
Description: A polyclonal antibody for detection of Claudin-11 from Human, Mouse, Rat. This Claudin-11 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Claudin-11 at AA range: 130-210

Claudin-11 Polyclonal Antibody
ABP55451-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human Claudin-11 at AA range: 130-210 Applications tips:
Description: A polyclonal antibody for detection of Claudin-11 from Human, Mouse, Rat. This Claudin-11 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Claudin-11 at AA range: 130-210

Claudin-11 Polyclonal Antibody
ABP55451-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human Claudin-11 at AA range: 130-210 Applications tips:
Description: A polyclonal antibody for detection of Claudin-11 from Human, Mouse, Rat. This Claudin-11 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Claudin-11 at AA range: 130-210

Claudin 11 Polyclonal Antibody
ABP58170-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human Claudin 11 Antibody protein Applications tips:
Description: A polyclonal antibody for detection of Claudin 11 from Human, Mouse, Rat. This Claudin 11 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Claudin 11 Antibody protein

Claudin 11 Polyclonal Antibody
ABP58170-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human Claudin 11 Antibody protein Applications tips:
Description: A polyclonal antibody for detection of Claudin 11 from Human, Mouse, Rat. This Claudin 11 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Claudin 11 Antibody protein

Claudin 11 Polyclonal Antibody
ABP58170-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human Claudin 11 Antibody protein Applications tips:
Description: A polyclonal antibody for detection of Claudin 11 from Human, Mouse, Rat. This Claudin 11 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Claudin 11 Antibody protein

Claudin 11 Blocking Peptide
AF0750-BP	Affbiotech	1mg	EUR 195

Claudin 11 Blocking Peptide
AF5364-BP	Affbiotech	1mg	EUR 195

Claudin-11 Polyclonal Antibody
ES6450-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Claudin-11 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Claudin-11 Polyclonal Antibody
ES6450-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Claudin-11 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- Claudin 11 antibody
FNab01733	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IHC: 1:20-1:200 IF: 1:20-1:200 Immunogen: claudin 11 Uniprot ID: O75508 Gene ID: 5010 Research Area: Neuroscience, Stem Cells, Developmental biology
Description: Antibody raised against Claudin 11

Anti-Claudin 11 antibody
PAab01733	Lifescience Market	100 ug	EUR 355

Anti-Claudin-11 antibody
STJ92310	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Claudin-11.

Anti-Claudin 11 antibody
STJ99632	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Claudin 11.

CLDN11 ELISA Kit (Human) (OKCD08767)
OKCD08767	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: CLDN11 belongs to the claudin family of tight junction associated proteins and is a major component of central nervous system myelin that is necessary for normal CNS function. There is growing evidence that the protein determines the permeability between layers of myelin sheaths via focal adhesion and, with its expression highly regulated during development, may play an important role in cellular proliferation and migration. In addition, the protein is a candidate autoantigen in the development of autoimmune demyelinating disease.The protein encoded by this gene belongs to the claudin family of tight junction associated proteins and is a major component of central nervous system myelin that is necessary for normal CNS function. There is growing evidence that the protein determines the permeability between layers of myelin sheaths via focal adhesion and, with its expression highly regulated during development, may play an important role in cellular proliferation and migration. In addition, the protein is a candidate autoantigen in the development of autoimmune demyelinating disease.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.065ng/mL

CLDN11 ELISA Kit (Human) (OKDD00193)
OKDD00193	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a major component of central nervous system (CNS) myelin and plays an important role in regulating proliferation and migration of oligodendrocytes. Mouse studies showed that the gene deficiency results in deafness and loss of the Sertoli cell epithelial phenotype in the testis. This protein is a tight junction protein at the human blood-testis barrier (BTB), and the BTB disruption is related to a dysfunction of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.059 ng/mL

Claudin 11 Colorimetric Cell-Based ELISA Kit (OKAG00614)
OKAG00614	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity:

Anti-Claudin 11 Monoclonal Antibody
M08381	BosterBio	100ug	EUR 397
Description: Rabbit Monoclonal Claudin 11 Antibody. Validated in Flow Cytometry, WB and tested in Human, Mouse, Rat.

Individual Reaction Mix 11
G065-11	ABM	200 reactions	EUR 167

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

CLDN11 antibody
70R-16444	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CLDN11 antibody

CLDN11 Antibody
32740-100ul	SAB	100ul	EUR 252

CLDN11 Antibody
1-CSB-PA005492GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CLDN11. Recognizes CLDN11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

CLDN11 Antibody
DF7042	Affbiotech	200ul	EUR 304
Description: CLDN11 Antibody detects endogenous levels of total CLDN11.

CLDN11 Antibody
1-CSB-PA581946	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CLDN11. Recognizes CLDN11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

CLDN11 Antibody
1-CSB-PA228236	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CLDN11. Recognizes CLDN11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CLDN11 Antibody
1-CSB-PA020196	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CLDN11. Recognizes CLDN11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

CLDN11 siRNA
20-abx911959	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CLDN11 siRNA
20-abx911960	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CLDN11 Antibody
ABD7042	Lifescience Market	100 ug	EUR 438

Human CLDN11 shRNA Plasmid
20-abx953327	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CLDN11 Recombinant Protein (Human)
RP007231	ABM	100 ug	Ask for price

Human Claudin 1 ELISA kit
E01C0381-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 1 ELISA kit
E01C0381-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 1 ELISA kit
E01C0381-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin-1 ELISA kit
E01C0973-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive for quantitative measurement of Human Claudin-1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin-1 ELISA kit
E01C0973-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive for quantitative measurement of Human Claudin-1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin-1 ELISA kit
E01C0973-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive for quantitative measurement of Human Claudin-1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Claudin 18 ELISA KIT|Human
EF008702	Lifescience Market	96 Tests	EUR 689

Claudin 22 ELISA KIT|Human
EF008703	Lifescience Market	96 Tests	EUR 689

Claudin 23 ELISA KIT|Human
EF008704	Lifescience Market	96 Tests	EUR 689

Claudin 7 ELISA KIT|Human
EF008706	Lifescience Market	96 Tests	EUR 689

Human Interleukin 11,IL-11 ELISA KIT
201-12-0102	SunredBio	96 tests	EUR 440
This Interleukin 11 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Kallikrein 11,KLK 11 ELISA Kit
201-12-0783	SunredBio	96 tests	EUR 440
This Kallikrein 11 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 11, IL-11 ELISA KIT
CSB-E04596h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 11, IL-11 in samples from serum, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 11, IL-11 ELISA KIT
1-CSB-E04596h	Cusabio	EUR 602.00 EUR 4238.00 EUR 2256.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 11, IL-11 in samples from serum, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Syntaxin 11 (Syntaxin 11) ELISA Kit
abx259864-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human IL-11(Interleukin 11) ELISA Kit
EH0174	FN Test	96T	EUR 476.25
Detection range: 31.25-2000 pg/ml Uniprot ID: P20809 Alias: IL-11(Interleukin 11)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Interleukin 11,IL-11 ELISA KIT
CN-03220H1	ChemNorm	96T	EUR 434

Human Interleukin 11,IL-11 ELISA KIT
CN-03220H2	ChemNorm	48T	EUR 284

Human Kallikrein 11,KLK 11 ELISA Kit
CN-03728H1	ChemNorm	96T	EUR 470

Human Kallikrein 11,KLK 11 ELISA Kit
CN-03728H2	ChemNorm	48T	EUR 320

Human Kallikrein 11(KLK 11)ELISA Kit
GA-E0799HM-48T	GenAsia Biotech	48T	EUR 289

Human Kallikrein 11(KLK 11)ELISA Kit
GA-E0799HM-96T	GenAsia Biotech	96T	EUR 466

Human Interleukin 11(IL-11)ELISA Kit
GA-E0141HM-48T	GenAsia Biotech	48T	EUR 289

Human Interleukin 11(IL-11)ELISA Kit
GA-E0141HM-96T	GenAsia Biotech	96T	EUR 466

Human Interleukin-11 (IL-11) ELISA Kit
LF-EK60040	Abfrontier	1×96T	EUR 790

Human Kallikrein 11(KLK 11)ELISA Kit
QY-E02953	Qayee Biotechnology	96T	EUR 361

Human Interleukin 11(IL-11)ELISA Kit
QY-E04330	Qayee Biotechnology	96T	EUR 400

CLDN11 Rabbit pAb
A12478-100ul	Abclonal	100 ul	EUR 308

CLDN11 Rabbit pAb
A12478-200ul	Abclonal	200 ul	EUR 459

CLDN11 Rabbit pAb
A12478-20ul	Abclonal	20 ul	EUR 183

CLDN11 Rabbit pAb
A12478-50ul	Abclonal	50 ul	EUR 223

CLDN11 Blocking Peptide
DF7042-BP	Affbiotech	1mg	EUR 195

Polyclonal CLDN11 Antibody
APR11592G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLDN11 . This antibody is tested and proven to work in the following applications:

CLDN11 cloning plasmid
CSB-CL005492HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 624 Sequence: atggtggccacgtgcctgcaggtggtgggcttcgtcacgagcttcgtgggctggatcggggtcatcgtgaccacctccaccaatgactgggtggtgacctgcggctacaccatccccacctgccgcaagctggatgagctgggctccaaggggctgtgggccgactgcgtcatggc Show more
Description: A cloning plasmid for the CLDN11 gene.

CLDN11 Rabbit pAb
A2593-100ul	Abclonal	100 ul	EUR 308

CLDN11 Rabbit pAb
A2593-200ul	Abclonal	200 ul	EUR 459

CLDN11 Rabbit pAb
A2593-20ul	Abclonal	20 ul	EUR 183

CLDN11 Rabbit pAb
A2593-50ul	Abclonal	50 ul	EUR 223

pCMV-SPORT6-CLDN11
PVT13135	Lifescience Market	2 ug	EUR 391

Anti-CLDN11 antibody
STJ114352	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a major component of central nervous system (CNS) myelin and plays an important role in regulating proliferation and migration of oligodendrocytes. Mouse studies showed that the gene deficiency results in deafness and loss of the Sertoli cell epithelial phenotype in the testis. This protein is a tight junction protein at the human blood-testis barrier (BTB), and the BTB disruption is related to a dysfunction of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-CLDN11 antibody
STJ23156	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a major component of central nervous system (CNS) myelin and plays an important role in regulating proliferation and migration of oligodendrocytes. Mouse studies showed that the gene deficiency results in deafness and loss of the Sertoli cell epithelial phenotype in the testis. This protein is a tight junction protein at the human blood-testis barrier (BTB), and the BTB disruption is related to a dysfunction of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified.

human claudin 14,CLDN14 ELISA Kit
201-12-1879	SunredBio	96 tests	EUR 440
This claudin 14 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 1 (CLDN1)ELISA kit
201-12-2301	SunredBio	96 tests	EUR 440
This Claudin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 2 (CLDN2)ELISA kit
201-12-2302	SunredBio	96 tests	EUR 440
This Claudin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 3 (CLDN3)ELISA kit
201-12-2303	SunredBio	96 tests	EUR 440
This Claudin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 5 (CLDN5)ELISA kit
201-12-2304	SunredBio	96 tests	EUR 440
This Claudin 5 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 6 (CLDN6)ELISA kit
201-12-2305	SunredBio	96 tests	EUR 440
This Claudin 6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 7 (CLDN7)ELISA kit
201-12-2306	SunredBio	96 tests	EUR 440
This Claudin 7 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 8 (CLDN8)ELISA kit
201-12-2307	SunredBio	96 tests	EUR 440
This Claudin 8 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 9 (CLDN9)ELISA kit
201-12-2308	SunredBio	96 tests	EUR 440
This Claudin 9 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 10 (CLDN10)ELISA kit
201-12-2309	SunredBio	96 tests	EUR 440
This Claudin 10 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 12 (CLDN12)ELISA kit
201-12-2311	SunredBio	96 tests	EUR 440
This Claudin 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 15 (CLDN15)ELISA kit
201-12-2312	SunredBio	96 tests	EUR 440
This Claudin 15 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 16 (CLDN16)ELISA kit
201-12-2313	SunredBio	96 tests	EUR 440
This Claudin 16 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 17 (CLDN17)ELISA kit
201-12-2314	SunredBio	96 tests	EUR 440
This Claudin 17 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 19 (CLDN19)ELISA kit
201-12-2315	SunredBio	96 tests	EUR 440
This Claudin 19 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 20 (CLDN20)ELISA kit
201-12-2316	SunredBio	96 tests	EUR 440
This Claudin 20 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 24 (CLDN24)ELISA kit
201-12-2317	SunredBio	96 tests	EUR 440
This Claudin 24 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 22 (CLDN22)ELISA kit
201-12-2318	SunredBio	96 tests	EUR 440
This Claudin 22 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 23 (CLDN23)ELISA kit
201-12-2319	SunredBio	96 tests	EUR 440
This Claudin 23 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 1 (CLDN1) ELISA Kit
DLR-CLDN1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Claudin 1 (CLDN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 1 (CLDN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Claudin 1 (CLDN1) ELISA Kit
DLR-CLDN1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Claudin 1 (CLDN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 1 (CLDN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Claudin 3 (CLDN3) ELISA Kit
DLR-CLDN3-Hu-48T	DL Develop	48T	EUR 517
Should the Human Claudin 3 (CLDN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 3 (CLDN3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Claudin 3 (CLDN3) ELISA Kit
DLR-CLDN3-Hu-96T	DL Develop	96T	EUR 673
Should the Human Claudin 3 (CLDN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 3 (CLDN3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Claudin 4 (CLDN4) ELISA Kit
DLR-CLDN4-Hu-48T	DL Develop	48T	EUR 517
Should the Human Claudin 4 (CLDN4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 4 (CLDN4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Claudin 4 (CLDN4) ELISA Kit
DLR-CLDN4-Hu-96T	DL Develop	96T	EUR 673
Should the Human Claudin 4 (CLDN4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 4 (CLDN4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Claudin 5 (CLDN5) ELISA Kit
DLR-CLDN5-Hu-48T	DL Develop	48T	EUR 517
Should the Human Claudin 5 (CLDN5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 5 (CLDN5) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Claudin 5 (CLDN5) ELISA Kit
DLR-CLDN5-Hu-96T	DL Develop	96T	EUR 673
Should the Human Claudin 5 (CLDN5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 5 (CLDN5) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Claudin 6 (CLDN6) ELISA Kit
DLR-CLDN6-Hu-48T	DL Develop	48T	EUR 554
Should the Human Claudin 6 (CLDN6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 6 (CLDN6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Claudin 6 (CLDN6) ELISA Kit
DLR-CLDN6-Hu-96T	DL Develop	96T	EUR 725
Should the Human Claudin 6 (CLDN6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 6 (CLDN6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Claudin 9 (CLDN9) ELISA Kit
DLR-CLDN9-Hu-48T	DL Develop	48T	EUR 554
Should the Human Claudin 9 (CLDN9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 9 (CLDN9) in samples from tissue homogenates or other biological fluids.

Human Claudin 9 (CLDN9) ELISA Kit
DLR-CLDN9-Hu-96T	DL Develop	96T	EUR 725
Should the Human Claudin 9 (CLDN9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 9 (CLDN9) in samples from tissue homogenates or other biological fluids.

Human CLDN1/ Claudin-1 ELISA Kit
E0504Hu	Sunlong	1 Kit	EUR 605

Human CLDN2/ Claudin-2 ELISA Kit
E0505Hu	Sunlong	1 Kit	EUR 605

Human CLDN3/ Claudin-3 ELISA Kit
E0506Hu	Sunlong	1 Kit	EUR 605

Human claudin 14,CLDN14 ELISA kit
E01C0969-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human claudin 14,CLDN14 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human claudin 14,CLDN14 ELISA kit
E01C0969-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human claudin 14,CLDN14 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human claudin 14,CLDN14 ELISA kit
E01C0969-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human claudin 14,CLDN14 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 4 (CLDN4) ELISA kit
E01C0970-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 4 (CLDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 4 (CLDN4) ELISA kit
E01C0970-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 4 (CLDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 4 (CLDN4) ELISA kit
E01C0970-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 4 (CLDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 10(CLDN10) ELISA kit
E01C0974-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 10(CLDN10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 10(CLDN10) ELISA kit
E01C0974-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 10(CLDN10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 10(CLDN10) ELISA kit
E01C0974-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 10(CLDN10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 12(CLDN12) ELISA kit
E01C0976-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 12(CLDN12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CLDN11(Claudin 11) ELISA Kit