Human DTNb(Dystrobrevin Beta) ELISA Kit

Human DTNb(Dystrobrevin Beta) ELISA Kit

To Order: Contact us

Human Dystrobrevin Beta (DTNb) ELISA Kit
DLR-DTNb-Hu-96T 96T
EUR 673
  • Should the Human Dystrobrevin Beta (DTNb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dystrobrevin Beta (DTNb) in samples from tissue homogenates or other biological fluids.
Human Dystrobrevin Beta (DTNb) ELISA Kit
RDR-DTNb-Hu-48Tests 48 Tests
EUR 544
Human Dystrobrevin Beta (DTNb) ELISA Kit
RDR-DTNb-Hu-96Tests 96 Tests
EUR 756
Human Dystrobrevin Beta (DTNb) ELISA Kit
RD-DTNb-Hu-48Tests 48 Tests
EUR 521
Human Dystrobrevin Beta (DTNb) ELISA Kit
RD-DTNb-Hu-96Tests 96 Tests
EUR 723
Human Dystrobrevin beta (DTNb) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Dystrobrevin beta, DTNB ELISA KIT
ELI-09370h 96 Tests
EUR 824
Human Dystrobrevin Beta(DTNb)ELISA Kit
QY-E00444 96T
EUR 374
Human Dystrobrevin Beta (DTNb) ELISA Kit
SEF385Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids.
Human Dystrobrevin Beta (DTNb) ELISA Kit
SEF385Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids.
Human Dystrobrevin Beta (DTNb) ELISA Kit
SEF385Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids.
Human Dystrobrevin Beta (DTNb) ELISA Kit
SEF385Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids.
Human Dystrobrevin Beta (DTNb) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dystrobrevin Beta elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dystrobrevin Beta (DTNb) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Dystrobrevin Beta (DTNB) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dystrobrevin Beta (DTNB) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dystrobrevin Beta (DTNb) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Dystrobrevin Beta (DTNB) Antibody
abx122407-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Dystrobrevin Beta (DTNb) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Dystrobrevin Beta (DTNB) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dystrobrevin Beta (DTNB) Antibody
abx232551-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Recombinant Dystrobrevin Beta (DTNb)
  • EUR 460.19
  • EUR 226.00
  • EUR 1450.72
  • EUR 550.24
  • EUR 1000.48
  • EUR 371.00
  • EUR 3476.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O60941
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Dystrobrevin Beta expressed in: E.coli
Mouse Dystrobrevin beta, Dtnb ELISA KIT
ELI-47723m 96 Tests
EUR 865
Human Dystrobrevin Beta (DTNb) Protein
  • EUR 648.00
  • EUR 272.00
  • EUR 1957.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Dystrobrevin beta (DTNb) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human DTNb (Dystrobrevin Beta)
ELK3317 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dystrobrevin Beta (DTN?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dystrobre
  • Show more
Description: A sandwich ELISA kit for detection of Dystrobrevin Beta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Dystrobrevin beta (DTNB)
KTE61971-48T 48T
EUR 332
  • Dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and bet
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dystrobrevin beta (DTNB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Dystrobrevin beta (DTNB)
KTE61971-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and bet
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dystrobrevin beta (DTNB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Dystrobrevin beta (DTNB)
KTE61971-96T 96T
EUR 539
  • Dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and bet
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dystrobrevin beta (DTNB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb)
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with APC.
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with Biotin.
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with Cy3.
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with FITC.
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with HRP.
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with PE.
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with APC-Cy7.
Recombinant human Dystrobrevin beta
P2840 100ug Ask for price
  • Uniprot ID: O60941
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Dystrobrevin beta
anti-Dystrobrevin beta
YF-PA11436 50 ul
EUR 363
Description: Mouse polyclonal to Dystrobrevin beta
anti-Dystrobrevin beta
YF-PA11437 50 ug
EUR 363
Description: Mouse polyclonal to Dystrobrevin beta
anti-Dystrobrevin beta
YF-PA23608 50 ul
EUR 334
Description: Mouse polyclonal to Dystrobrevin beta
Dtnb/ Rat Dtnb ELISA Kit
ELI-47526r 96 Tests
EUR 886
Anti-Dystrobrevin beta (1D3)
YF-MA12738 100 ug
EUR 363
Description: Mouse monoclonal to Dystrobrevin beta
EF009230 96 Tests
EUR 689
DTNB ELISA Kit (Human) (OKCD00463)
OKCD00463 96 Wells
EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL
DTNb ELISA Kit (Human) (OKDD00246)
OKDD00246 96 Wells
EUR 975
Description: Description of target: This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL
Human Dystrobrevin alpha, DTNA ELISA KIT
ELI-31605h 96 Tests
EUR 824
Human Dystrobrevin Alpha (DTNA) ELISA Kit
abx386993-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Dystrobrevin Alpha(DTNa)ELISA Kit
QY-E00445 96T
EUR 374
HY-15915 5g
EUR 147
Mouse Dystrobrevin alpha, Dtna ELISA KIT
ELI-47722m 96 Tests
EUR 865
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
DTNB antibody
70R-16945 50 ul
EUR 435
Description: Rabbit polyclonal DTNB antibody
DTNB Antibody
36425-100ul 100ul
EUR 252
DTNB antibody
10R-6896 100 ul
EUR 691
Description: Mouse monoclonal DTNB antibody
DTNB antibody
10R-6897 100 ul
EUR 691
Description: Mouse monoclonal DTNB antibody
DTNB antibody
10R-6898 100 ul
EUR 691
Description: Mouse monoclonal DTNB antibody
DTNB antibody
10R-6899 100 ul
EUR 691
Description: Mouse monoclonal DTNB antibody
DTNB antibody
10R-6900 100 ul
EUR 691
Description: Mouse monoclonal DTNB antibody
DTNB Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DTNB. Recognizes DTNB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
DTNB Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DTNB. Recognizes DTNB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000
DTNB antibody
70R-3432 50 ug
EUR 467
Description: Rabbit polyclonal DTNB antibody raised against the C terminal of DTNB
DTNB Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DTNB. Recognizes DTNB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Human Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit
abx250983-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Human DTNB shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DTNB Recombinant Protein (Human)
RP009880 100 ug Ask for price
anti-Dystrobrevin alpha
YF-PA11433 50 ug
EUR 363
Description: Mouse polyclonal to Dystrobrevin alpha
anti-Dystrobrevin alpha
YF-PA11434 50 ul
EUR 363
Description: Mouse polyclonal to Dystrobrevin alpha
anti-Dystrobrevin alpha
YF-PA11435 50 ug
EUR 363
Description: Mouse polyclonal to Dystrobrevin alpha
DTNB Rabbit pAb
A12866-100ul 100 ul
EUR 308
DTNB Rabbit pAb
A12866-200ul 200 ul
EUR 459
DTNB Rabbit pAb
A12866-20ul 20 ul
EUR 183
DTNB Rabbit pAb
A12866-50ul 50 ul
EUR 223
DTNB Blocking Peptide
33R-1524 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DTNB antibody, catalog no. 70R-3432
DTNB Conjugated Antibody
C36425 100ul
EUR 397
DTNB cloning plasmid
CSB-CL007217HU-10ug 10ug
EUR 581
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1683
  • Sequence: atgattgaggaaagtgggaacaagcggaagaccatggcagagaagaggcagctgttcatagaaatgcgtgctcagaattttgatgtcatacgactatcaacttacagaacagcctgcaaattacgatttgtacaaaaacgatgcaaccttcatcttgttgatatctggaacatga
  • Show more
Description: A cloning plasmid for the DTNB gene.
anti- DTNB antibody
FNab02551 100µg
EUR 548.75
  • Immunogen: dystrobrevin, beta
  • Uniprot ID: O60941
  • Gene ID: 1838
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against DTNB
Anti-DTNB antibody
PAab02551 100 ug
EUR 386
PVT12852 2 ug
EUR 391
Anti-DTNB antibody
STJ114732 100 µl
EUR 277
Description: This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin.
DTNB (Ellman's Reagent)
DB0113 5g
EUR 97.85
  • Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related
DTNB ORF Vector (Human) (pORF)
ORF003294 1.0 ug DNA
EUR 95
Cow Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit
abx517260-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Chicken Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit
abx517261-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit
abx517263-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Rat Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit
abx517264-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Dystrobrevin Alpha (DTNA) Antibody
abx026894-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Dystrobrevin Alpha (DTNA) Antibody
abx026894-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Dystrobrevin Alpha (DTNA) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dystrobrevin Alpha (DTNA) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dystrobrevin Alpha (DTNA) Antibody
abx232550-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Rat DTNB shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse DTNB shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DTNB Recombinant Protein (Rat)
RP198725 100 ug Ask for price
DTNB Recombinant Protein (Mouse)
RP130163 100 ug Ask for price

Human DTNb(Dystrobrevin Beta) ELISA Kit