Human KERA(Keratocan) ELISA Kit

Human KERA(Keratocan) ELISA Kit

To Order: Contact us

Human Keratocan (KERA) ELISA Kit
DLR-KERA-Hu-96T	DL Develop	96T	EUR 673
Should the Human Keratocan (KERA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratocan (KERA) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Keratocan (KERA) ELISA Kit
RDR-KERA-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Keratocan (KERA) ELISA Kit
RDR-KERA-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Keratocan (KERA) ELISA Kit
RD-KERA-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Keratocan (KERA) ELISA Kit
RD-KERA-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Keratocan (KERA) ELISA Kit
20-abx152122	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Keratocan (KERA) ELISA Kit
abx252686-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human KERA(Keratocan) ELISA Kit
EH3283	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: O60938 Alias: KERA/Keratan sulfate proteoglycan keratocan/KTN/SLRR2B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Keratocan, KERA ELISA KIT
ELI-47900h	Lifescience Market	96 Tests	EUR 824

Human Keratocan(KERA)ELISA Kit
QY-E02810	Qayee Biotechnology	96T	EUR 361

Human Keratocan ELISA Kit (KERA)
RK01722	Abclonal	96 Tests	EUR 521

Human Keratocan (KERA) ELISA Kit
SEC553Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.

Human Keratocan (KERA) ELISA Kit
SEC553Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.

Human Keratocan (KERA) ELISA Kit
SEC553Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.

Human Keratocan (KERA) ELISA Kit
SEC553Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.

Human Keratocan (KERA) ELISA Kit
4-SEC553Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Keratocan elisa. Alternative names of the recognized antigen: CNA2 SLRR2B Keratocan Proteoglycan Keratan sulfate proteoglycan keratocan
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratocan (KERA) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Chicken Keratocan, KERA ELISA KIT
ELI-15851c	Lifescience Market	96 Tests	EUR 928

Bovine Keratocan, KERA ELISA KIT
ELI-31165b	Lifescience Market	96 Tests	EUR 928

Mouse Keratocan, Kera ELISA KIT
ELI-44193m	Lifescience Market	96 Tests	EUR 865

Chicken Keratocan (KERA) ELISA Kit
abx354671-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Keratocan (KERA) ELISA Kit
abx354947-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Keratocan (KERA) ELISA Kit
abx355100-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Keratocan (KERA) ELISA Kit
abx355269-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Keratocan (KERA) ELISA Kit
abx355357-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Mouse Keratocan (KERA) ELISA Kit
abx389686-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Keratocan (KERA) Antibody
abx026920-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Keratocan (KERA) Antibody
abx026920-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Keratocan (KERA) Antibody
20-abx177263	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Keratocan (KERA) Antibody
20-abx104884	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Keratocan (KERA) Antibody
20-abx129874	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Keratocan (KERA) Antibody
20-abx173253	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Keratocan (KERA) Antibody
20-abx321066	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Keratocan (KERA)
4-RPC553Bo01	Cloud-Clone	EUR 539.04 EUR 247.00 EUR 1746.40 EUR 648.80 EUR 1197.60 EUR 424.00 EUR 4216.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O62702 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 35.0kDa Isoelectric Point: Inquire
Description: Recombinant Bovine Keratocan expressed in: E.coli

Recombinant Keratocan (KERa)
4-RPC553Mu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O35367 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 35.2kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Keratocan expressed in: E.coli

ELISA kit for Human KERA (Keratocan)
E-EL-H1794	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's KERA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human KERA. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human KERA (Keratocan) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human KERA (Keratocan)
ELK3438	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratocan (KERA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratocan (KERA). Show more
Description: A sandwich ELISA kit for detection of Keratocan from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Keratocan (KERA)
KTE61923-48T	Abbkine	48T	EUR 332
Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratocan (KERA)
KTE61923-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratocan (KERA)
KTE61923-96T	Abbkine	96T	EUR 539
Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Keratocan (KERA) CLIA Kit
abx197204-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Keratocan (KERA) CLIA Kit
20-abx493762	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Keratocan (KERA) Protein
20-abx654110	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Cow Keratocan (KERA) Protein
20-abx166318	Abbexa	EUR 746.00 EUR 300.00 EUR 2346.00 EUR 899.00 EUR 537.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Keratocan (KERa) Protein
20-abx167289	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CLIA kit for Human KERA (Keratocan)
E-CL-H1116	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's KERA CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human KERA . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human KERA (Keratocan) in samples from Serum, Plasma, Cell supernatant

Keratocan (KERA) Polyclonal Antibody (Bovine)
4-PAC553Bo01	Cloud-Clone	EUR 276.00 EUR 2972.00 EUR 730.00 EUR 352.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA)

Keratocan (KERA) Polyclonal Antibody (Bovine), APC
4-PAC553Bo01-APC	Cloud-Clone	EUR 389.00 EUR 3905.00 EUR 1070.00 EUR 503.00 EUR 238.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with APC.

Keratocan (KERA) Polyclonal Antibody (Bovine), Biotinylated
4-PAC553Bo01-Biotin	Cloud-Clone	EUR 344.00 EUR 2922.00 EUR 843.00 EUR 427.00 EUR 233.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with Biotin.

Keratocan (KERA) Polyclonal Antibody (Bovine), Cy3
4-PAC553Bo01-Cy3	Cloud-Clone	EUR 477.00 EUR 5165.00 EUR 1385.00 EUR 629.00 EUR 276.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with Cy3.

Keratocan (KERA) Polyclonal Antibody (Bovine), FITC
4-PAC553Bo01-FITC	Cloud-Clone	EUR 331.00 EUR 3144.00 EUR 876.00 EUR 422.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with FITC.

Keratocan (KERA) Polyclonal Antibody (Bovine), HRP
4-PAC553Bo01-HRP	Cloud-Clone	EUR 354.00 EUR 3401.00 EUR 944.00 EUR 452.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with HRP.

Keratocan (KERA) Polyclonal Antibody (Bovine), PE
4-PAC553Bo01-PE	Cloud-Clone	EUR 331.00 EUR 3144.00 EUR 876.00 EUR 422.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with PE.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat)
4-PAC553Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA)

Keratocan (KERA) Polyclonal Antibody (Bovine), APC-Cy7
4-PAC553Bo01-APC-Cy7	Cloud-Clone	EUR 659.00 EUR 7690.00 EUR 2020.00 EUR 886.00 EUR 356.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with APC-Cy7.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), APC
4-PAC553Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with APC.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAC553Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with Biotin.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAC553Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with Cy3.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), FITC
4-PAC553Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with FITC.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), HRP
4-PAC553Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with HRP.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), PE
4-PAC553Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with PE.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAC553Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with APC-Cy7.

KERA ELISA KIT|Human
EF006946	Lifescience Market	96 Tests	EUR 689

KERA ELISA Kit (Human) (OKCD01682)
OKCD01682	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May be important in developing and maintaining corneal transparency and for the structure of the stromal matrix. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.127 ng/mL

KERA Antibody
1-CSB-PA012149ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KERA. Recognizes KERA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

KERA siRNA
20-abx921431	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KERA siRNA
20-abx921432	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Anti-Keratocan Antibody
PB9653	BosterBio	100ug/vial	EUR 294

Human KERA shRNA Plasmid
20-abx957578	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KERA Recombinant Protein (Human)
RP016747	ABM	100 ug	Ask for price

KERA cloning plasmid
CSB-CL012149HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1059 Sequence: atggcaggcacaatctgtttcatcatgtgggtgttattcataacagacactgtgtggtctagaagtgtaaggcaggtctatgaagtacatgattcagatgattggactattcatgacttcgagtgtcccatggaatgtttctgcccacccagttttcctactgctttatattgtg Show more
Description: A cloning plasmid for the KERA gene.

KERA ORF Vector (Human) (pORF)
ORF005583	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse KERA shRNA Plasmid
20-abx971173	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KERA Recombinant Protein (Rat)
RP207077	ABM	100 ug	Ask for price

Human KERA(Keratocan) ELISA Kit