Human KERA(Keratocan) ELISA Kit

Human KERA(Keratocan) ELISA Kit

To Order: Contact us

Human Keratocan (KERA) ELISA Kit
DLR-KERA-Hu-96T 96T
EUR 673
  • Should the Human Keratocan (KERA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratocan (KERA) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Keratocan (KERA) ELISA Kit
RDR-KERA-Hu-48Tests 48 Tests
EUR 544
Human Keratocan (KERA) ELISA Kit
RDR-KERA-Hu-96Tests 96 Tests
EUR 756
Human Keratocan (KERA) ELISA Kit
RD-KERA-Hu-48Tests 48 Tests
EUR 521
Human Keratocan (KERA) ELISA Kit
RD-KERA-Hu-96Tests 96 Tests
EUR 723
Human Keratocan (KERA) ELISA Kit
20-abx152122
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratocan (KERA) ELISA Kit
abx252686-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human KERA(Keratocan) ELISA Kit
EH3283 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: O60938
  • Alias: KERA/Keratan sulfate proteoglycan keratocan/KTN/SLRR2B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Keratocan, KERA ELISA KIT
ELI-47900h 96 Tests
EUR 824
Human Keratocan(KERA)ELISA Kit
QY-E02810 96T
EUR 361
Human Keratocan ELISA Kit (KERA)
RK01722 96 Tests
EUR 521
Human Keratocan (KERA) ELISA Kit
SEC553Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.
Human Keratocan (KERA) ELISA Kit
SEC553Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.
Human Keratocan (KERA) ELISA Kit
SEC553Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.
Human Keratocan (KERA) ELISA Kit
SEC553Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.
Human Keratocan (KERA) ELISA Kit
4-SEC553Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Keratocan elisa. Alternative names of the recognized antigen: CNA2
  • SLRR2B
  • Keratocan Proteoglycan
  • Keratan sulfate proteoglycan keratocan
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratocan (KERA) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Chicken Keratocan, KERA ELISA KIT
ELI-15851c 96 Tests
EUR 928
Bovine Keratocan, KERA ELISA KIT
ELI-31165b 96 Tests
EUR 928
Mouse Keratocan, Kera ELISA KIT
ELI-44193m 96 Tests
EUR 865
Chicken Keratocan (KERA) ELISA Kit
abx354671-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Monkey Keratocan (KERA) ELISA Kit
abx354947-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Keratocan (KERA) ELISA Kit
abx355100-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Keratocan (KERA) ELISA Kit
abx355269-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Sheep Keratocan (KERA) ELISA Kit
abx355357-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.
Mouse Keratocan (KERA) ELISA Kit
abx389686-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Keratocan (KERA) Antibody
abx026920-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Keratocan (KERA) Antibody
abx026920-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Keratocan (KERA) Antibody
20-abx177263
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Keratocan (KERA) Antibody
20-abx104884
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Keratocan (KERA) Antibody
20-abx129874
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Keratocan (KERA) Antibody
20-abx173253
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Keratocan (KERA) Antibody
20-abx321066
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Keratocan (KERA)
4-RPC553Bo01
  • EUR 539.04
  • EUR 247.00
  • EUR 1746.40
  • EUR 648.80
  • EUR 1197.60
  • EUR 424.00
  • EUR 4216.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O62702
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Bovine Keratocan expressed in: E.coli
Recombinant Keratocan (KERa)
4-RPC553Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O35367
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Keratocan expressed in: E.coli
ELISA kit for Human KERA (Keratocan)
E-EL-H1794 1 plate of 96 wells
EUR 534
  • Gentaur's KERA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human KERA. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human KERA (Keratocan) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human KERA (Keratocan)
ELK3438 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratocan (KERA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratocan (KERA).
  • Show more
Description: A sandwich ELISA kit for detection of Keratocan from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Keratocan (KERA)
KTE61923-48T 48T
EUR 332
  • Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Keratocan (KERA)
KTE61923-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Keratocan (KERA)
KTE61923-96T 96T
EUR 539
  • Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Keratocan (KERA) CLIA Kit
abx197204-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Keratocan (KERA) CLIA Kit
20-abx493762
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Keratocan (KERA) Protein
20-abx654110
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Cow Keratocan (KERA) Protein
20-abx166318
  • EUR 746.00
  • EUR 300.00
  • EUR 2346.00
  • EUR 899.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Keratocan (KERa) Protein
20-abx167289
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
CLIA kit for Human KERA (Keratocan)
E-CL-H1116 1 plate of 96 wells
EUR 584
  • Gentaur's KERA CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human KERA . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human KERA (Keratocan) in samples from Serum, Plasma, Cell supernatant
Keratocan (KERA) Polyclonal Antibody (Bovine)
4-PAC553Bo01
  • EUR 276.00
  • EUR 2972.00
  • EUR 730.00
  • EUR 352.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA)
Keratocan (KERA) Polyclonal Antibody (Bovine), APC
4-PAC553Bo01-APC
  • EUR 389.00
  • EUR 3905.00
  • EUR 1070.00
  • EUR 503.00
  • EUR 238.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with APC.
Keratocan (KERA) Polyclonal Antibody (Bovine), Biotinylated
4-PAC553Bo01-Biotin
  • EUR 344.00
  • EUR 2922.00
  • EUR 843.00
  • EUR 427.00
  • EUR 233.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with Biotin.
Keratocan (KERA) Polyclonal Antibody (Bovine), Cy3
4-PAC553Bo01-Cy3
  • EUR 477.00
  • EUR 5165.00
  • EUR 1385.00
  • EUR 629.00
  • EUR 276.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with Cy3.
Keratocan (KERA) Polyclonal Antibody (Bovine), FITC
4-PAC553Bo01-FITC
  • EUR 331.00
  • EUR 3144.00
  • EUR 876.00
  • EUR 422.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with FITC.
Keratocan (KERA) Polyclonal Antibody (Bovine), HRP
4-PAC553Bo01-HRP
  • EUR 354.00
  • EUR 3401.00
  • EUR 944.00
  • EUR 452.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with HRP.
Keratocan (KERA) Polyclonal Antibody (Bovine), PE
4-PAC553Bo01-PE
  • EUR 331.00
  • EUR 3144.00
  • EUR 876.00
  • EUR 422.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with PE.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat)
4-PAC553Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA)
Keratocan (KERA) Polyclonal Antibody (Bovine), APC-Cy7
4-PAC553Bo01-APC-Cy7
  • EUR 659.00
  • EUR 7690.00
  • EUR 2020.00
  • EUR 886.00
  • EUR 356.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with APC-Cy7.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), APC
4-PAC553Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with APC.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAC553Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with Biotin.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAC553Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with Cy3.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), FITC
4-PAC553Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with FITC.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), HRP
4-PAC553Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with HRP.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), PE
4-PAC553Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with PE.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAC553Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with APC-Cy7.
KERA ELISA KIT|Human
EF006946 96 Tests
EUR 689
KERA ELISA Kit (Human) (OKCD01682)
OKCD01682 96 Wells
EUR 831
Description: Description of target: May be important in developing and maintaining corneal transparency and for the structure of the stromal matrix. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.127 ng/mL
KERA Antibody
1-CSB-PA012149ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KERA. Recognizes KERA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
KERA siRNA
20-abx921431
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KERA siRNA
20-abx921432
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Anti-Keratocan Antibody
PB9653 100ug/vial
EUR 294
Human KERA shRNA Plasmid
20-abx957578
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
KERA Recombinant Protein (Human)
RP016747 100 ug Ask for price
KERA cloning plasmid
CSB-CL012149HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1059
  • Sequence: atggcaggcacaatctgtttcatcatgtgggtgttattcataacagacactgtgtggtctagaagtgtaaggcaggtctatgaagtacatgattcagatgattggactattcatgacttcgagtgtcccatggaatgtttctgcccacccagttttcctactgctttatattgtg
  • Show more
Description: A cloning plasmid for the KERA gene.
KERA ORF Vector (Human) (pORF)
ORF005583 1.0 ug DNA
EUR 95
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Mouse KERA shRNA Plasmid
20-abx971173
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
KERA Recombinant Protein (Rat)
RP207077 100 ug Ask for price

Human KERA(Keratocan) ELISA Kit