Human KRT2(Keratin 2) ELISA Kit

Human KRT2(Keratin 2) ELISA Kit

To Order: Contact us

Human Keratin 2 (KRT2) ELISA Kit
DLR-KRT2-Hu-96T 96T
EUR 621
  • Should the Human Keratin 2 (KRT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 2 (KRT2) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Keratin 2 (KRT2) ELISA Kit
RD-KRT2-Hu-48Tests 48 Tests
EUR 478
Human Keratin 2 (KRT2) ELISA Kit
RD-KRT2-Hu-96Tests 96 Tests
EUR 662
Human Keratin 2 (KRT2) ELISA Kit
RDR-KRT2-Hu-48Tests 48 Tests
EUR 500
Human Keratin 2 (KRT2) ELISA Kit
RDR-KRT2-Hu-96Tests 96 Tests
EUR 692
Human Keratin 2 (KRT2) ELISA Kit
20-abx152111
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 2 (KRT2) ELISA Kit
abx250879-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Keratin 2(KRT2)ELISA Kit
201-12-3211 96 tests
EUR 440
  • This Keratin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Keratin 2 (KRT2) ELISA Kit
SEA491Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 2 (KRT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 2 (KRT2) in serum, plasma, tissue homogenates and other biological fluids.
Human Keratin 2 (KRT2) ELISA Kit
SEA491Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 2 (KRT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 2 (KRT2) in serum, plasma, tissue homogenates and other biological fluids.
Human Keratin 2 (KRT2) ELISA Kit
SEA491Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 2 (KRT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 2 (KRT2) in serum, plasma, tissue homogenates and other biological fluids.
Human Keratin 2 (KRT2) ELISA Kit
SEA491Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 2 (KRT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 2 (KRT2) in serum, plasma, tissue homogenates and other biological fluids.
Human Keratin 2 (KRT2) ELISA Kit
4-SEA491Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Keratin 2 elisa. Alternative names of the recognized antigen: KRT2A
  • CK2
  • KRTE
  • Cytokeratin 2
  • Keratin 2A
  • Keratin 2E
  • Epidermal Ichthyosis Bullosa Of Siemens
  • Keratin, type II cytoskeletal 2 epidermal
  • Epithelial keratin-2e
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratin 2 (KRT2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Keratin 2 ELISA Kit (KRT2)
RK01745 96 Tests
EUR 521
Human Keratin 2(KRT2)ELISA Kit
QY-E00974 96T
EUR 361
Dog Keratin 2 (KRT2) ELISA Kit
abx516851-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Keratin 2 (KRT2) ELISA Kit
abx516853-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Keratin 2 (KRT2) ELISA Kit
abx516854-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Keratin 2(KRT2)ELISA Kit
GA-E0855MS-48T 48T
EUR 336
Mouse Keratin 2(KRT2)ELISA Kit
GA-E0855MS-96T 96T
EUR 534
Rat KeRatin 2(KRT2)ELISA Kit
QY-E10611 96T
EUR 361
ELISA kit for Human KRT2 (Keratin 2)
ELK3602 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratin 2 (KRT2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratin 2 (KRT2).
  • Show more
Description: A sandwich ELISA kit for detection of Keratin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Keratin 2 (KRT2) CLIA Kit
20-abx491555
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Keratin 2 (KRT2) Antibody
20-abx129632
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Keratin 2 (KRT2) Antibody
20-abx100356
  • EUR 300.00
  • EUR 133.00
  • EUR 759.00
  • EUR 398.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Keratin 2 (KRT2) Antibody
20-abx100357
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Keratin 2 (KRT2) Antibody
20-abx100358
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Keratin 2 (KRT2) Antibody
20-abx173248
  • EUR 314.00
  • EUR 787.00
  • EUR 411.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.
Recombinant Keratin 2 (KRT2)
4-RPA491Hu01
  • EUR 431.52
  • EUR 218.00
  • EUR 1343.20
  • EUR 514.40
  • EUR 928.80
  • EUR 352.00
  • EUR 3208.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P35908
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Keratin 2 expressed in: E.coli
Recombinant Keratin 2 (KRT2)
4-RPA491Mu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q3TTY5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.8kDa
  • Isoelectric Point: 5.4
Description: Recombinant Mouse Keratin 2 expressed in: E.coli
Recombinant Keratin 2 (KRT2)
4-RPA491Ra01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6IG02
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Keratin 2 expressed in: E.coli
Recombinant Keratin 2 (KRT2)
4-RPA491Ra02
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6IG02
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Keratin 2 expressed in: E.coli
Human Keratin 2 (KRT2) Protein
20-abx067618
  • EUR 606.00
  • EUR 258.00
  • EUR 1817.00
  • EUR 718.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat Keratin 2 (KRT2) Protein
20-abx067619
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Rat Keratin 2 (KRT2) Protein
20-abx067620
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Keratin 2 (KRT2) Protein
20-abx167202
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Keratin 2 (KRT2) Antibody (Biotin)
20-abx273325
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Keratin 2 (KRT2) Polyclonal Antibody (Human)
4-PAA491Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2)
Keratin 2 (KRT2) Polyclonal Antibody (Human), APC
4-PAA491Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with APC.
Keratin 2 (KRT2) Polyclonal Antibody (Human), Biotinylated
4-PAA491Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with Biotin.
Keratin 2 (KRT2) Polyclonal Antibody (Human), Cy3
4-PAA491Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with Cy3.
Keratin 2 (KRT2) Polyclonal Antibody (Human), FITC
4-PAA491Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with FITC.
Keratin 2 (KRT2) Polyclonal Antibody (Human), HRP
4-PAA491Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with HRP.
Keratin 2 (KRT2) Polyclonal Antibody (Human), PE
4-PAA491Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with PE.
Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat)
4-PAA491Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2)
Keratin 2 (KRT2) Polyclonal Antibody (Mouse)
4-PAA491Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2)
Keratin 2 (KRT2) Polyclonal Antibody (Rat)
4-PAA491Ra02
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2)
Human KRT2/ Keratin, type II cytoskeletal 2 epidermal ELISA Kit
E1404Hu 1 Kit
EUR 571
Human KRT2(Keratin, type II cytoskeletal 2 epidermal) ELISA Kit
EH1589 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P35908
  • Alias: KRT2/Keratin, type II cytoskeletal 2 epiderma/Type-II keratin Kb2/Keratin-2e/K2e/Keratin-2 epidermis/Cytokeratin-2e/CK-2e/Epithelial keratin-2e/KRT2A/KRT2E/KRTE
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Keratin, type II cytoskeletal 2 epidermal, KRT2 ELISA KIT
ELI-04653h 96 Tests
EUR 824
Keratin 2 (KRT2) Polyclonal Antibody (Human), APC-Cy7
4-PAA491Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with APC-Cy7.
Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), APC
4-PAA491Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with APC.
Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAA491Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with Biotin.
Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), Cy3
4-PAA491Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with Cy3.
Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), FITC
4-PAA491Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with FITC.
Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), HRP
4-PAA491Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with HRP.
Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), PE
4-PAA491Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with PE.
Keratin 2 (KRT2) Polyclonal Antibody (Mouse), APC
4-PAA491Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with APC.
Keratin 2 (KRT2) Polyclonal Antibody (Mouse), Biotinylated
4-PAA491Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with Biotin.
Keratin 2 (KRT2) Polyclonal Antibody (Mouse), Cy3
4-PAA491Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with Cy3.
Keratin 2 (KRT2) Polyclonal Antibody (Mouse), FITC
4-PAA491Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with FITC.
Keratin 2 (KRT2) Polyclonal Antibody (Mouse), HRP
4-PAA491Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with HRP.
Keratin 2 (KRT2) Polyclonal Antibody (Mouse), PE
4-PAA491Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with PE.
Keratin 2 (KRT2) Polyclonal Antibody (Rat), APC
4-PAA491Ra02-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with APC.
Keratin 2 (KRT2) Polyclonal Antibody (Rat), Biotinylated
4-PAA491Ra02-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with Biotin.
Keratin 2 (KRT2) Polyclonal Antibody (Rat), Cy3
4-PAA491Ra02-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with Cy3.
Keratin 2 (KRT2) Polyclonal Antibody (Rat), FITC
4-PAA491Ra02-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with FITC.
Keratin 2 (KRT2) Polyclonal Antibody (Rat), HRP
4-PAA491Ra02-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with HRP.
Keratin 2 (KRT2) Polyclonal Antibody (Rat), PE
4-PAA491Ra02-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with PE.
Mouse Keratin, type II cytoskeletal 2 epidermal, Krt2 ELISA KIT
ELI-04652m 96 Tests
EUR 865
Krt2/ Rat Krt2 ELISA Kit
ELI-04654r 96 Tests
EUR 886
Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAA491Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with APC-Cy7.
Keratin, Type II Cytoskeletal 2 Epidermal (KRT2) Antibody
20-abx126071
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Keratin, Type II Cytoskeletal 2 Epidermal (KRT2) Antibody
20-abx327388
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Keratin, Type II Cytoskeletal 2 Epidermal (KRT2) Antibody
20-abx216486
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Keratin, Type II Cytoskeletal 2 Epidermal (KRT2) Antibody
20-abx211764
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Keratin 2 (KRT2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA491Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with APC-Cy7.
Keratin 2 (KRT2) Polyclonal Antibody (Rat), APC-Cy7
4-PAA491Ra02-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with APC-Cy7.
Human KRT2 ELISA Kit
ELA-E1427h 96 Tests
EUR 824
KRT2 ELISA KIT|Human
EF005745 96 Tests
EUR 689
Mouse KeMousein 2(KRT2)ELISA Kit
QY-E20878 96T
EUR 361
KRT2 ELISA Kit (Human) (OKAN05492)
OKAN05492 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL
KRT2 ELISA Kit (Human) (OKCD06389)
OKCD06389 96 Wells
EUR 753
Description: Description of target: KRT2A is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma.The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL
KRT2 ELISA Kit (Human) (OKEH01005)
OKEH01005 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Canine KRT2 ELISA KIT
ELI-04651d 96 Tests
EUR 928
KRT2 ELISA Kit (Mouse) (OKEH05503)
OKEH05503 96 Wells
EUR 662
Description: Description of target: Probably contributes to terminal cornification. Associated with keratinocyte activation, proliferation and keratinization.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL
KRT2 ELISA Kit (Rat) (OKEH06174)
OKEH06174 96 Wells
EUR 662
Description: Description of target: Probably contributes to terminal cornification. Associated with keratinocyte activation, proliferation and keratinization.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL
KRT2 siRNA
20-abx902902
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KRT2 siRNA
20-abx921979
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KRT2 siRNA
20-abx921980
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KRT2 Antibody
35627-100ul 100ul
EUR 252
KRT2 Antibody
1-CSB-PA005499
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against KRT2. Recognizes KRT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
KRT2 Antibody
1-CSB-PA443781
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT2. Recognizes KRT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
pMD19-KRT2
PVT17955 2 ug
EUR 231
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
KRT2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1165203 1.0 ug DNA
EUR 154
Human Keratin- associated protein 2- 2, KRTAP2-2 ELISA KIT
ELI-21083h 96 Tests
EUR 824
Human KRT2 shRNA Plasmid
20-abx952610
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
KRT2 Recombinant Protein (Human)
RP040489 100 ug Ask for price
Human Keratin 9 ELISA Kit
ELA-E2283h 96 Tests
EUR 824
Human Keratin 8 ELISA Kit
ELA-E2287h 96 Tests
EUR 824
Human Keratin 16 ELISA Kit
ELA-E8852h 96 Tests
EUR 824
Human Keratin 15 ELISA Kit
ELA-E8853h 96 Tests
EUR 824
Human Keratin 12 ELISA Kit
ELA-E8860h 96 Tests
EUR 824
Human Keratin 19 ELISA Kit
ELA-E9126h 96 Tests
EUR 824
Human Keratin 20 ELISA Kit
ELA-E9127h 96 Tests
EUR 824
Human Keratin 13 ELISA Kit
ELA-E9417h 96 Tests
EUR 824
Human Keratin- associated protein 10- 2, KRTAP10-2 ELISA KIT
ELI-12484h 96 Tests
EUR 824
Human Keratin- associated protein 21- 2, KRTAP21-2 ELISA KIT
ELI-12489h 96 Tests
EUR 824
Human Keratin- associated protein 22- 2, KRTAP22-2 ELISA KIT
ELI-12490h 96 Tests
EUR 824
Human Keratin- associated protein 5- 2, KRTAP5-2 ELISA KIT
ELI-12492h 96 Tests
EUR 824
Human Keratin- associated protein 6- 2, KRTAP6-2 ELISA KIT
ELI-12495h 96 Tests
EUR 824
Human Keratin- associated protein 9- 2, KRTAP9-2 ELISA KIT
ELI-14434h 96 Tests
EUR 824
Human Keratin- associated protein 4- 2, KRTAP4-2 ELISA KIT
ELI-21085h 96 Tests
EUR 824
Human Keratin- associated protein 19- 2, KRTAP19-2 ELISA KIT
ELI-08758h 96 Tests
EUR 824
Human Keratin- associated protein 20- 2, KRTAP20-2 ELISA KIT
ELI-08759h 96 Tests
EUR 824
Human Keratin- associated protein 12- 2, KRTAP12-2 ELISA KIT
ELI-37261h 96 Tests
EUR 824
Human Keratin- associated protein 3- 2, KRTAP3-2 ELISA KIT
ELI-37262h 96 Tests
EUR 824
Human Keratin- associated protein 13- 2, KRTAP13-2 ELISA KIT
ELI-43316h 96 Tests
EUR 824
KRT2 Conjugated Antibody
C35627 100ul
EUR 397
KRT2 cloning plasmid
CSB-CL012535HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1920
  • Sequence: ATGAGTTGTCAGATCTCTTGCAAATCTCGAGGAAGAGGAGGAGGTGGAGGAGGATTCCGGGGCTTCAGCAGCGGCTCAGCTGTGGTGTCTGGTGGAAGCCGGAGATCAACTTCCAGCTTCTCCTGCTTGAGCCGCCATGGTGGTGGTGGCGGGGGCTTCGGTGGAGGCGGCTTTG
  • Show more
Description: A cloning plasmid for the KRT2 gene.
KRT2 Rabbit pAb
A10375-100ul 100 ul
EUR 308
KRT2 Rabbit pAb
A10375-200ul 200 ul
EUR 459
KRT2 Rabbit pAb
A10375-20ul 20 ul
EUR 183
KRT2 Rabbit pAb
A10375-50ul 50 ul
EUR 223
Anti-KRT2 antibody
STJ112411 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.
KRT2 ORF Vector (Human) (pORF)
ORF013497 1.0 ug DNA
EUR 354
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Krt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3383903 1.0 ug DNA
EUR 154
Krt2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6718803 1.0 ug DNA
EUR 154
Human Keratin 20 (KRT20) ELISA Kit
abx570153-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Keratin 17 (KRT17) ELISA Kit
abx570272-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Keratin 8 (KRT8) ELISA Kit
abx570440-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Keratin 1 (KRT1) ELISA Kit
abx570545-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Keratin 9 (KRT9) ELISA Kit
abx571224-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Keratin 16 (KRT16) ELISA Kit
abx571262-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Keratin 18 (KRT18) ELISA Kit
abx574112-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Keratin 19 (KRT19) ELISA Kit
abx574257-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Keratin 10 (KRT10) ELISA Kit
abx574505-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Keratin 13 (KRT13) ELISA Kit
abx574530-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Keratin 5 (KRT5) ELISA Kit
abx574970-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Keratin 6A (KRT6A) ELISA Kit
abx574972-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Human Keratin growth factor ELISA kit
E01K0023-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Keratin growth factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Keratin growth factor ELISA kit
E01K0023-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Keratin growth factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Keratin growth factor ELISA kit
E01K0023-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Keratin growth factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Keratin 4 (KRT4) ELISA kit
E01K0099-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Keratin 4 (KRT4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Keratin 4 (KRT4) ELISA kit
E01K0099-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Keratin 4 (KRT4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Keratin 4 (KRT4) ELISA kit
E01K0099-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Keratin 4 (KRT4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Keratin 17 (KRT17) ELISA kit
E01C0760-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Keratin 17 (KRT17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Keratin 17 (KRT17) ELISA kit
E01C0760-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Keratin 17 (KRT17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Keratin 17 (KRT17) ELISA kit
E01C0760-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Keratin 17 (KRT17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Anti keratin antibody ELISA kit
E01A0771-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Anti keratin antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Anti keratin antibody ELISA kit
E01A0771-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Anti keratin antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Anti keratin antibody ELISA kit
E01A0771-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Anti keratin antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human epidermal keratin(EK)ELISA Kit
GA-E1640HM-48T 48T
EUR 289
Human epidermal keratin(EK)ELISA Kit
GA-E1640HM-96T 96T
EUR 466
Human Keratin 15 (KRT15) ELISA Kit
20-abx156681
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 17 (KRT17) ELISA Kit
20-abx156744
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 1 (KRT1) ELISA Kit
20-abx152103
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 10 (KRT10) ELISA Kit
20-abx152104
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 12 (KRT12) ELISA Kit
20-abx152105
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 13 (KRT13) ELISA Kit
20-abx152106
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 14 (KRT14) ELISA Kit
20-abx152107
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 16 (KRT16) ELISA Kit
20-abx152108
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 18 (KRT18) ELISA Kit
20-abx152109
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 19 (KRT19) ELISA Kit
20-abx152110
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 20 (KRT20) ELISA Kit
20-abx152112
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 33A (KRT33A) ELISA Kit
20-abx152113
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 4 (KRT4) ELISA Kit
20-abx152114
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 40 (KRT40) ELISA Kit
20-abx152115
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 5 (KRT5) ELISA Kit
20-abx152116
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 6A (KRT6A) ELISA Kit
20-abx152117
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 7 (KRT7) ELISA Kit
20-abx152118
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 8 (KRT8) ELISA Kit
20-abx152119
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 81 (KRT81) ELISA Kit
20-abx152120
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 9 (KRT9) ELISA Kit
20-abx152121
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratin 17 (KRT17) ELISA Kit
abx052192-96tests 96 tests
EUR 786
  • Shipped within 5-10 working days.
Human Keratin 17 (KRT17) ELISA Kit
abx251269-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Keratin 1 (KRT1) ELISA Kit
abx251540-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Keratin 10 (KRT10) ELISA Kit
abx251545-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Keratin 13 (KRT13) ELISA Kit
abx252200-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Keratin 18 (KRT18) ELISA Kit
abx252203-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Keratin 19 (KRT19) ELISA Kit
abx252204-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Keratin 20 (KRT20) ELISA Kit
abx252205-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Keratin 23 (KRT23) ELISA Kit
20-abx388207
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human Keratin 33B (KRT33B) ELISA Kit
abx388208-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Keratin 34 (KRT34) ELISA Kit
abx388209-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Keratin 36 (KRT36) ELISA Kit
abx388210-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Keratin 6B (KRT6B) ELISA Kit
abx388212-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Keratin 80 (KRT80) ELISA Kit
abx388213-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Keratin 6A (KRT6A) ELISA Kit
abx250371-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Human epidermal keratin,EK ELISA Kit
201-12-1624 96 tests
EUR 440
  • This epidermal keratin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Keratin 1 (KRT1) ELISA Kit
DLR-KRT1-Hu-48T 48T
EUR 479
  • Should the Human Keratin 1 (KRT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 1 (KRT1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Keratin 1 (KRT1) ELISA Kit
DLR-KRT1-Hu-96T 96T
EUR 621
  • Should the Human Keratin 1 (KRT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 1 (KRT1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Keratin 10 (KRT10) ELISA Kit
DLR-KRT10-Hu-48T 48T
EUR 498
  • Should the Human Keratin 10 (KRT10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 10 (KRT10) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Keratin 10 (KRT10) ELISA Kit
DLR-KRT10-Hu-96T 96T
EUR 647
  • Should the Human Keratin 10 (KRT10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 10 (KRT10) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Keratin 13 (KRT13) ELISA Kit
DLR-KRT13-Hu-48T 48T
EUR 498
  • Should the Human Keratin 13 (KRT13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 13 (KRT13) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Keratin 13 (KRT13) ELISA Kit
DLR-KRT13-Hu-96T 96T
EUR 647
  • Should the Human Keratin 13 (KRT13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 13 (KRT13) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Keratin 14 (KRT14) ELISA Kit
DLR-KRT14-Hu-48T 48T
EUR 479
  • Should the Human Keratin 14 (KRT14) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 14 (KRT14) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Keratin 14 (KRT14) ELISA Kit
DLR-KRT14-Hu-96T 96T
EUR 621
  • Should the Human Keratin 14 (KRT14) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 14 (KRT14) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Keratin 16 (KRT16) ELISA Kit
DLR-KRT16-Hu-48T 48T
EUR 479
  • Should the Human Keratin 16 (KRT16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 16 (KRT16) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Keratin 16 (KRT16) ELISA Kit
DLR-KRT16-Hu-96T 96T
EUR 621
  • Should the Human Keratin 16 (KRT16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 16 (KRT16) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Keratin 17 (KRT17) ELISA Kit
DLR-KRT17-Hu-48T 48T
EUR 498
  • Should the Human Keratin 17 (KRT17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 17 (KRT17) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Keratin 17 (KRT17) ELISA Kit
DLR-KRT17-Hu-96T 96T
EUR 647
  • Should the Human Keratin 17 (KRT17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 17 (KRT17) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Keratin 18 (KRT18) ELISA Kit
DLR-KRT18-Hu-48T 48T
EUR 498
  • Should the Human Keratin 18 (KRT18) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 18 (KRT18) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Keratin 18 (KRT18) ELISA Kit
DLR-KRT18-Hu-96T 96T
EUR 647
  • Should the Human Keratin 18 (KRT18) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 18 (KRT18) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Keratin 19 (KRT19) ELISA Kit
DLR-KRT19-Hu-48T 48T
EUR 498
  • Should the Human Keratin 19 (KRT19) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 19 (KRT19) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Keratin 19 (KRT19) ELISA Kit
DLR-KRT19-Hu-96T 96T
EUR 647
  • Should the Human Keratin 19 (KRT19) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 19 (KRT19) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Keratin 20 (KRT20) ELISA Kit
DLR-KRT20-Hu-48T 48T
EUR 498
  • Should the Human Keratin 20 (KRT20) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 20 (KRT20) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Keratin 20 (KRT20) ELISA Kit
DLR-KRT20-Hu-96T 96T
EUR 647
  • Should the Human Keratin 20 (KRT20) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 20 (KRT20) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Keratin 33A (KRT33A) ELISA Kit
DLR-KRT33A-Hu-48T 48T
EUR 554
  • Should the Human Keratin 33A (KRT33A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 33A (KRT33A) in samples from serum, plasma or other biological fluids.
Human Keratin 33A (KRT33A) ELISA Kit
DLR-KRT33A-Hu-96T 96T
EUR 725
  • Should the Human Keratin 33A (KRT33A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 33A (KRT33A) in samples from serum, plasma or other biological fluids.
Human Keratin 4 (KRT4) ELISA Kit
DLR-KRT4-Hu-48T 48T
EUR 479
  • Should the Human Keratin 4 (KRT4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 4 (KRT4) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Keratin 4 (KRT4) ELISA Kit
DLR-KRT4-Hu-96T 96T
EUR 621
  • Should the Human Keratin 4 (KRT4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 4 (KRT4) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Keratin 40 (KRT40) ELISA Kit
DLR-KRT40-Hu-48T 48T
EUR 554
  • Should the Human Keratin 40 (KRT40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 40 (KRT40) in samples from serum, plasma or other biological fluids.
Human Keratin 40 (KRT40) ELISA Kit
DLR-KRT40-Hu-96T 96T
EUR 725
  • Should the Human Keratin 40 (KRT40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 40 (KRT40) in samples from serum, plasma or other biological fluids.
Human Keratin 5 (KRT5) ELISA Kit
DLR-KRT5-Hu-48T 48T
EUR 479
  • Should the Human Keratin 5 (KRT5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 5 (KRT5) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Keratin 5 (KRT5) ELISA Kit
DLR-KRT5-Hu-96T 96T
EUR 621
  • Should the Human Keratin 5 (KRT5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 5 (KRT5) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Keratin 6A (KRT6A) ELISA Kit
DLR-KRT6A-Hu-48T 48T
EUR 517
  • Should the Human Keratin 6A (KRT6A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 6A (KRT6A) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Keratin 6A (KRT6A) ELISA Kit
DLR-KRT6A-Hu-96T 96T
EUR 673
  • Should the Human Keratin 6A (KRT6A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 6A (KRT6A) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Keratin 7 (KRT7) ELISA Kit
DLR-KRT7-Hu-48T 48T
EUR 479
  • Should the Human Keratin 7 (KRT7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 7 (KRT7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Keratin 7 (KRT7) ELISA Kit
DLR-KRT7-Hu-96T 96T
EUR 621
  • Should the Human Keratin 7 (KRT7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 7 (KRT7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Keratin 8 (KRT8) ELISA Kit
DLR-KRT8-Hu-48T 48T
EUR 517
  • Should the Human Keratin 8 (KRT8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 8 (KRT8) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Keratin 8 (KRT8) ELISA Kit
DLR-KRT8-Hu-96T 96T
EUR 673
  • Should the Human Keratin 8 (KRT8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 8 (KRT8) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Keratin 81 (KRT81) ELISA Kit
DLR-KRT81-Hu-48T 48T
EUR 554
  • Should the Human Keratin 81 (KRT81) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 81 (KRT81) in samples from tissue homogenates or other biological fluids.
Human Keratin 81 (KRT81) ELISA Kit
DLR-KRT81-Hu-96T 96T
EUR 725
  • Should the Human Keratin 81 (KRT81) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 81 (KRT81) in samples from tissue homogenates or other biological fluids.
Human Keratin 9 (KRT9) ELISA Kit
DLR-KRT9-Hu-48T 48T
EUR 479
  • Should the Human Keratin 9 (KRT9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 9 (KRT9) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Keratin 9 (KRT9) ELISA Kit
DLR-KRT9-Hu-96T 96T
EUR 621
  • Should the Human Keratin 9 (KRT9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 9 (KRT9) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Anti-keratin antibody ELISA Kit
CSB-E04965h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitativeindirect ELISA kit for measuring Human Anti-keratin antibody in samples from serum. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Anti-keratin antibody ELISA Kit
1-CSB-E04965h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitativeindirect ELISA kit for measuring Human Anti-keratin antibody in samples from serum. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human epidermal keratin,EK ELISA Kit
CN-04254H1 96T
EUR 438
Human epidermal keratin,EK ELISA Kit
CN-04254H2 48T
EUR 289
Human Keratin 10 (KRT10) ELISA Kit
SEB691Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 10 (KRT10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 10 (KRT10) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Keratin 10 (KRT10) ELISA Kit
SEB691Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 10 (KRT10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 10 (KRT10) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Keratin 10 (KRT10) ELISA Kit
SEB691Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 10 (KRT10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 10 (KRT10) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Keratin 10 (KRT10) ELISA Kit
SEB691Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 10 (KRT10) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 10 (KRT10) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Keratin 10 (KRT10) ELISA Kit
4-SEB691Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Keratin 10 elisa. Alternative names of the recognized antigen: K10
  • CK10
  • KPP
  • Cytokeratin 10
  • Epidermolytic Hyperkeratosis
  • Keratosis Palmaris Et Plantaris
  • Keratin, type I cytoskeletal 10
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratin 10 (KRT10) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Keratin 17 (KRT17) ELISA Kit
SEB822Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 17 (KRT17) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 17 (KRT17) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human KRT2(Keratin 2) ELISA Kit