Human MFI2(Melanotransferrin) ELISA Kit

Human MFI2(Melanotransferrin) ELISA Kit

To Order: Contact us

Human Melanotransferrin (MFI2) ELISA Kit

RDR-MFI2-Hu-96Tests 96 Tests
EUR 724

Human Melanotransferrin (MFI2) ELISA Kit

RD-MFI2-Hu-48Tests 48 Tests
EUR 500

Human Melanotransferrin (MFI2) ELISA Kit

RD-MFI2-Hu-96Tests 96 Tests
EUR 692

Human Melanotransferrin (MFI2)ELISA Kit

201-12-2492 96 tests
EUR 440
  • This Melanotransferrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Melanotransferrin(MFI2) ELISA kit

CSB-EL013754HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Melanotransferrin (MFI2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Melanotransferrin(MFI2) ELISA kit

1-CSB-EL013754HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Melanotransferrin(MFI2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human MFI2(Melanotransferrin) ELISA Kit

EH3348 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P08582
  • Alias: MFI2/CD228/MAP97/MFI2/MTF/p97/antigen p97(melanoma associated) identified by monoclonal antibodies 133.2 and96.5/CD228/CD228 antigen/FLJ38863/MAP97Melanoma-associated antigen p97/melanotrans
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Melanotransferrin, MFI2 ELISA KIT

ELI-51146h 96 Tests
EUR 824

Human Melanotransferrin(MFI2)ELISA Kit

QY-E03122 96T
EUR 361

Human Melanotransferrin (MFI2) ELISA Kit

SEB677Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids.

Human Melanotransferrin (MFI2) ELISA Kit

SEB677Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids.

Human Melanotransferrin (MFI2) ELISA Kit

SEB677Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids.

Human Melanotransferrin (MFI2) ELISA Kit

SEB677Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids.

Human Melanotransferrin (MFI2) ELISA Kit

4-SEB677Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Melanotransferrin elisa. Alternative names of the recognized antigen: CD228
  • MAP97
  • MTF1
  • Antigen P97(Melanoma Associated)
  • Membrane-Bound Transferrin-Like Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Melanotransferrin (MFI2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rabbit Melanotransferrin, Mfi2 ELISA KIT

ELI-28974Ra 96 Tests
EUR 928

Mouse Melanotransferrin, Mfi2 ELISA KIT

ELI-45742m 96 Tests
EUR 865

Rat Melanotransferrin(MFI2)ELISA Kit

QY-E10590 96T
EUR 361

Mouse Melanotransferrin(MFI2)ELISA Kit

QY-E20987 96T
EUR 361

Rabbit Melanotransferrin (Mfi2)

1-CSB-EP013754RB
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 91.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rabbit Melanotransferrin(Mfi2),partial expressed in E.coli

Melanotransferrin (MFI2) Antibody

20-abx005099
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Melanotransferrin (Mfi2) Antibody

20-abx111013
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Melanotransferrin (MFI2) Antibody

20-abx128153
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Melanotransferrin (MFI2) Antibody

20-abx173530
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Melanotransferrin (MFI2) Antibody

abx235149-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Melanotransferrin (MFI2)

4-RPB677Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P08582
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 41.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Melanotransferrin expressed in: E.coli

ELISA kit for Human MFI2 (Melanotransferrin)

E-EL-H2405 1 plate of 96 wells
EUR 534
  • Gentaur's MFI2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MFI2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MFI2 (Melanotransferrin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human MFI2 (Melanotransferrin)

ELK3234 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Melanotransferrin (MFI2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Melanotra
  • Show more
Description: A sandwich ELISA kit for detection of Melanotransferrin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Melanotransferrin (MFI2)

KTE61638-48T 48T
EUR 332
  • Melanotransferrin encoded by MFI2 is a cell-surface glycoprotein found on melanoma cells. Melanotransferrin shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding functio
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Melanotransferrin (MFI2)

KTE61638-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Melanotransferrin encoded by MFI2 is a cell-surface glycoprotein found on melanoma cells. Melanotransferrin shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding functio
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Melanotransferrin (MFI2)

KTE61638-96T 96T
EUR 539
  • Melanotransferrin encoded by MFI2 is a cell-surface glycoprotein found on melanoma cells. Melanotransferrin shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding functio
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Melanotransferrin (MFI2) CLIA Kit

abx197271-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Melanotransferrin (MFI2) CLIA Kit

20-abx492980
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Melanotransferrin (MFI2) Protein

20-abx167031
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Rabbit Melanotransferrin (MFI2)

KTE90099-48T 48T
EUR 354
  • The protein encoded by Melanotransferrin (MFI2) is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Melanotransferrin (MFI2)

KTE90099-5platesof96wells 5 plates of 96 wells
EUR 2252
  • The protein encoded by Melanotransferrin (MFI2) is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Melanotransferrin (MFI2)

KTE90099-96T 96T
EUR 572
  • The protein encoded by Melanotransferrin (MFI2) is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Melanotransferrin (MFI2)

KTE71043-48T 48T
EUR 332
  • The protein encoded by MELTF is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not y
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Melanotransferrin (MFI2)

KTE71043-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by MELTF is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not y
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Melanotransferrin (MFI2)

KTE71043-96T 96T
EUR 539
  • The protein encoded by MELTF is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not y
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

CLIA kit for Human MFI2 (Melanotransferrin)

E-CL-H1410 1 plate of 96 wells
EUR 584
  • Gentaur's MFI2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MFI2 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human MFI2 (Melanotransferrin) in samples from Serum, Plasma, Cell supernatant

Melanotransferrin (MFI2) Polyclonal Antibody (Human)

4-PAB677Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2)

Melanotransferrin (MFI2) Polyclonal Antibody (Human), APC

4-PAB677Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with APC.

Melanotransferrin (MFI2) Polyclonal Antibody (Human), Biotinylated

4-PAB677Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with Biotin.

Melanotransferrin (MFI2) Polyclonal Antibody (Human), Cy3

4-PAB677Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with Cy3.

Melanotransferrin (MFI2) Polyclonal Antibody (Human), FITC

4-PAB677Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with FITC.

Melanotransferrin (MFI2) Polyclonal Antibody (Human), HRP

4-PAB677Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with HRP.

Melanotransferrin (MFI2) Polyclonal Antibody (Human), PE

4-PAB677Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with PE.

Melanotransferrin (MFI2) Polyclonal Antibody (Human), APC-Cy7

4-PAB677Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with APC-Cy7.

MFI2 ELISA KIT|Human

EF006974 96 Tests
EUR 689

Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-100ug

QP6357-ec-100ug 100ug
EUR 707

Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-10ug

QP6357-ec-10ug 10ug
EUR 326

Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-1mg

QP6357-ec-1mg 1mg
EUR 2303

Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-200ug

QP6357-ec-200ug 200ug
EUR 1115

Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-500ug

QP6357-ec-500ug 500ug
EUR 1514

Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-50ug

QP6357-ec-50ug 50ug
EUR 435

Human Melanotransferrin (MELTF) ELISA Kit

20-abx152303
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Melanotransferrin (MELTF) ELISA Kit

abx252749-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Chicken Melanotransferrin (MELTF) ELISA Kit

abx354703-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Melanotransferrin (MELTF) ELISA Kit

abx355024-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Melanotransferrin (MELTF) ELISA Kit

abx355170-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Melanotransferrin (MELTF) ELISA Kit

abx355246-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Melanotransferrin (MELTF) ELISA Kit

abx355389-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

MFI2 antibody

70R-18494 50 ul
EUR 435
Description: Rabbit polyclonal MFI2 antibody

MFI2 antibody

70R-10040 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MFI2 antibody

MFI2 antibody

39073-100ul 100ul
EUR 252

MFI2 Antibody

1-CSB-PA013754GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MFI2. Recognizes MFI2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MFI2 siRNA

20-abx924039
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MFI2 siRNA

20-abx924040
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-MFI2

YF-PA13138 50 ug
EUR 363
Description: Mouse polyclonal to MFI2

Human MFI2 shRNA Plasmid

20-abx952883
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MFI2 Recombinant Protein (Human)

RP019246 100 ug Ask for price

MFI2 Blocking Peptide

33R-1830 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MFI2 antibody, catalog no. 70R-10040

MFI2 Conjugated Antibody

C39073 100ul
EUR 397

MFI2 cloning plasmid

CSB-CL013754HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 909
  • Sequence: atgcggggtccgagcggggctctgtggctgctcctggctctgcgcaccgtgctcggtggcatggaggtgcggtggtgcgccacctcggacccagagcagcacaagtgcggcaacatgagcgaggccttccgggaagcgggcatccagccctccctcctctgcgtccggggcacctc
  • Show more
Description: A cloning plasmid for the MFI2 gene.

MFI2 Rabbit pAb

A6653-100ul 100 ul
EUR 308

MFI2 Rabbit pAb

A6653-200ul 200 ul
EUR 459

MFI2 Rabbit pAb

A6653-20ul 20 ul
EUR 183

MFI2 Rabbit pAb

A6653-50ul 50 ul
EUR 223

anti- MFI2 antibody

FNab05149 100µg
EUR 548.75
  • Immunogen: antigen p97(melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
  • Uniprot ID: P08582
  • Research Area: Immunology
Description: Antibody raised against MFI2

Anti-MFI2 antibody

PAab05149 100 ug
EUR 386

Anti-MFI2 antibody

STJ28736 100 µl
EUR 277
Description: The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants.

Anti-MFI2 (1F7)

YF-MA14236 200 ul
EUR 363
Description: Mouse monoclonal to MFI2

MFI2 ORF Vector (Human) (pORF)

ORF006416 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Mouse MFI2 shRNA Plasmid

20-abx974022
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MFI2 Recombinant Protein (Mouse)

RP150407 100 ug Ask for price

MFI2 Recombinant Protein (Rat)

RP211520 100 ug Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

MFI2 sgRNA CRISPR Lentivector set (Human)

K1296301 3 x 1.0 ug
EUR 339

MFI2-AS1 ORF Vector (Human) (pORF)

ORF023512 1.0 ug DNA Ask for price

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Human MFI2(Melanotransferrin) ELISA Kit