Human MT1M(Metallothionein 1M) ELISA Kit

Human MT1M(Metallothionein 1M) ELISA Kit

To Order: Contact us

Human Metallothionein 1M (MT1M) ELISA Kit
RD-MT1M-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Metallothionein 1M (MT1M) ELISA Kit
RD-MT1M-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Metallothionein 1M (MT1M) ELISA Kit
20-abx152315	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Metallothionein 1M (MT1M) ELISA Kit
abx252781-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human MT1M(Metallothionein 1M) ELISA Kit
EH3389	FN Test	96T	EUR 524.1
Detection range: 3.125-200 ng/ml Uniprot ID: Q8N339 Alias: MT1M/Metallothionein 1M
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human Metallothionein- 1M, MT1M ELISA KIT
ELI-23225h	Lifescience Market	96 Tests	EUR 824

Human Metallothionein 1M (MT1M) ELISA Kit
CED792Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 1M (MT1M) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Metallothionein 1M (MT1M) in serum, plasma and other biological fluids.

Human Metallothionein 1M (MT1M) ELISA Kit
CED792Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 1M (MT1M) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Metallothionein 1M (MT1M) in serum, plasma and other biological fluids.

Human Metallothionein 1M (MT1M) ELISA Kit
CED792Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 1M (MT1M) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Metallothionein 1M (MT1M) in serum, plasma and other biological fluids.

Human Metallothionein 1M (MT1M) ELISA Kit
CED792Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 1M (MT1M) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Metallothionein 1M (MT1M) in serum, plasma and other biological fluids.

Human Metallothionein 1M (MT1M) ELISA Kit
4-CED792Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Metallothionein 1M elisa. Alternative names of the recognized antigen: MT1K
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Metallothionein 1M (MT1M) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Metallothionein 1M(MT1M)ELISA Kit
QY-E02760	Qayee Biotechnology	96T	EUR 361

Metallothionein 1M (MT1M) Antibody
20-abx177538	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Metallothionein 1M (MT1M) Antibody
20-abx173548	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Metallothionein-1M (MT1M) Antibody
20-abx306602	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Metallothionein 1M (MT1M) Protein
20-abx654351	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Monkey Metallothionein 1M (MT1M) ELISA Kit
abx359910-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Metallothionein 1M (MT1M) ELISA Kit
abx361714-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Metallothionein 1M (MT1M) ELISA Kit
abx362222-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Metallothionein 1M (MT1M) ELISA Kit
abx355851-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Metallothionein 1M (MT1M) ELISA Kit
abx364488-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

for Metallothionein 1M (MT1M)ELISA kit
SED792Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Metallothionein 1M (MT1M) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Metallothionein 1M (MT1M) in Tissue homogenates, cell lysates and other biological fluids.

for Metallothionein 1M (MT1M)ELISA kit
SED792Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Metallothionein 1M (MT1M) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Metallothionein 1M (MT1M) in Tissue homogenates, cell lysates and other biological fluids.

for Metallothionein 1M (MT1M)ELISA kit
SED792Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Metallothionein 1M (MT1M) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Metallothionein 1M (MT1M) in Tissue homogenates, cell lysates and other biological fluids.

for Metallothionein 1M (MT1M)ELISA kit
SED792Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Metallothionein 1M (MT1M) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Metallothionein 1M (MT1M) in Tissue homogenates, cell lysates and other biological fluids.

ELISA Kit for Metallothionein 1M (MT1M)
4-SED792Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Metallothionein 1M elisa. Alternative names of the recognized antigen: MT1K
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Metallothionein 1M (MT1M) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Metallothionein 1M (MT1M) CLIA Kit
abx197278-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Metallothionein 1M (MT1M) CLIA Kit
20-abx490508	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human MT1M (Metallothionein 1M)
E-EL-H0605	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's MT1M ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MT1M. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MT1M (Metallothionein 1M) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human MT1M (Metallothionein 1M)
ELK3542	ELK Biotech	1 plate of 96 wells	EUR 432
A monoclonal antibody specific to Metallothionein 1M (MT1M) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Metallothionein 1M (MT1M) and unlabeled Metallothionein 1M (MT1M) (Standards or sa Show more
Description: A competitive Inhibition ELISA kit for detection of Metallothionein 1M from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Metallothionein-1M (MT1M)
KTE61508-48T	Abbkine	48T	EUR 332
MT1M encodes a member of the metallothionein superfamily, type 1 family. Metallothioneins have a high content of cysteine residues that bind various heavy metals. These genes are transcriptionally regulated by both heavy metals and glucocorticoids.
Description: Quantitative sandwich ELISA for measuring Human Metallothionein-1M (MT1M) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Metallothionein-1M (MT1M)
KTE61508-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MT1M encodes a member of the metallothionein superfamily, type 1 family. Metallothioneins have a high content of cysteine residues that bind various heavy metals. These genes are transcriptionally regulated by both heavy metals and glucocorticoids.
Description: Quantitative sandwich ELISA for measuring Human Metallothionein-1M (MT1M) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Metallothionein-1M (MT1M)
KTE61508-96T	Abbkine	96T	EUR 539
MT1M encodes a member of the metallothionein superfamily, type 1 family. Metallothioneins have a high content of cysteine residues that bind various heavy metals. These genes are transcriptionally regulated by both heavy metals and glucocorticoids.
Description: Quantitative sandwich ELISA for measuring Human Metallothionein-1M (MT1M) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Metallothionein-1M (MT1M) Antibody (HRP)
20-abx306603	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Metallothionein-1M (MT1M) Antibody (FITC)
20-abx306604	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Metallothionein-1M (MT1M) Antibody (Biotin)
20-abx306605	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

CLIA kit for Human MT1M (Metallothionein 1M)
E-CL-H0467	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's MT1M CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MT1M . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human MT1M (Metallothionein 1M) in samples from Serum, Plasma, Cell supernatant

MT1M ELISA KIT|Human
EF006992	Lifescience Market	96 Tests	EUR 689

Human Metallothionein ELISA kit
E01M0030-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein ELISA kit
E01M0030-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein ELISA kit
E01M0030-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MT1M Antibody
1-CSB-PA17429A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MT1M. Recognizes MT1M from Human. This antibody is Unconjugated. Tested in the following application: ELISA

MT1M siRNA
20-abx924840	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human Protein phosphatase 1M, PPM1M ELISA KIT
ELI-12754h	Lifescience Market	96 Tests	EUR 824

Human MT1M shRNA Plasmid
20-abx952987	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MT1M Recombinant Protein (Human)
RP020218	ABM	100 ug	Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Metallothionein,MT ELISA Kit
201-12-1734	SunredBio	96 tests	EUR 440
This Metallothionein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Metallothionein 2 ELISA kit
E01M0345-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Metallothionein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 2 ELISA kit
E01M0345-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Metallothionein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 2 ELISA kit
E01M0345-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Metallothionein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 3 ELISA kit
E01M0366-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 3 ELISA kit
E01M0366-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 3 ELISA kit
E01M0366-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 1 ELISA kit
E01M0551-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Metallothionein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 1 ELISA kit
E01M0551-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Metallothionein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 1 ELISA kit
E01M0551-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Metallothionein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zn Metallothionein ELISA kit
E01Z0002-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Zn Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zn Metallothionein ELISA kit
E01Z0002-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Zn Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zn Metallothionein ELISA kit
E01Z0002-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Zn Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein,MT ELISA Kit
CN-04360H1	ChemNorm	96T	EUR 438

Human Metallothionein,MT ELISA Kit
CN-04360H2	ChemNorm	48T	EUR 289

Human Metallothionein, MT ELISA Kit
CSB-E09060h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Metallothionein, MT in samples from serum, plasma, cell culture supernates, tissue homogenates, urine, saliva. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Metallothionein, MT ELISA Kit
1-CSB-E09060h	Cusabio	EUR 602.00 EUR 4238.00 EUR 2256.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Metallothionein, MT in samples from serum, plasma, cell culture supernates, tissue homogenates, urine, saliva. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Metallothionein(MT)ELISA Kit
GA-E1750HM-48T	GenAsia Biotech	48T	EUR 289

Human Metallothionein(MT)ELISA Kit
GA-E1750HM-96T	GenAsia Biotech	96T	EUR 466

Human Metallothionein(MT)ELISA Kit
QY-E02768	Qayee Biotechnology	96T	EUR 374

MT1M cloning plasmid
CSB-CL847621HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 186 Sequence: atggaccccaactgctcctgcaccactggtgtctcctgcgcctgcaccggctcctgcaagtgcaaagagtgcaaatgcacctcctgcaagaagagctgctgctcctgctgccccgtgggctgtgccaagtgtgcccacggctgtgtctgcaaagggacgttggagaactgcagctg Show more
Description: A cloning plasmid for the MT1M gene.

MT1M Polyclonal Antibody
A59942	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

pENTR223-MT1M vector
PVT11973	Lifescience Market	2 ug	EUR 308

Rat Metallothionein ELISA kit
E02M0030-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Metallothionein ELISA kit
E02M0030-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Metallothionein ELISA kit
E02M0030-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Metallothionein ELISA kit
E04M0030-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Metallothionein ELISA kit
E04M0030-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Metallothionein ELISA kit
E04M0030-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Metallothionein ELISA kit
E03M0030-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Metallothionein ELISA kit
E03M0030-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Metallothionein ELISA kit
E03M0030-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Metallothionein ELISA Kit
ELA-E1119m	Lifescience Market	96 Tests	EUR 865

Rat Metallothionein ELISA Kit
ELA-E1119r	Lifescience Market	96 Tests	EUR 886

Goat Metallothionein ELISA kit
E06M0030-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Metallothionein ELISA kit
E06M0030-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Metallothionein ELISA kit
E06M0030-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Metallothionein ELISA kit
E08M0030-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Metallothionein ELISA kit
E08M0030-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Metallothionein ELISA kit
E08M0030-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Metallothionein ELISA kit
E07M0030-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Metallothionein ELISA kit
E07M0030-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Metallothionein ELISA kit
E07M0030-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Metallothionein ELISA kit
E09M0030-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Metallothionein ELISA kit
E09M0030-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Metallothionein ELISA kit
E09M0030-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Metallothionein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MT1M ORF Vector (Human) (pORF)
ORF006740	ABM	1.0 ug DNA	EUR 95

Human Metallothionein 2,MT2 ELISA Kit
201-12-1424	SunredBio	96 tests	EUR 440
This Metallothionein 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Metallothionein 1 (MT1) ELISA Kit
DLR-MT1-Hu-48T	DL Develop	48T	EUR 498
Should the Human Metallothionein 1 (MT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Metallothionein 1 (MT1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Metallothionein 1 (MT1) ELISA Kit
DLR-MT1-Hu-96T	DL Develop	96T	EUR 647
Should the Human Metallothionein 1 (MT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Metallothionein 1 (MT1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Metallothionein 1E (MT1E) ELISA Kit
DLR-MT1E-Hu-48T	DL Develop	48T	EUR 517
Should the Human Metallothionein 1E (MT1E) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Metallothionein 1E (MT1E) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Metallothionein 1E (MT1E) ELISA Kit
DLR-MT1E-Hu-96T	DL Develop	96T	EUR 673
Should the Human Metallothionein 1E (MT1E) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Metallothionein 1E (MT1E) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Metallothionein 2 (MT2) ELISA Kit
DLR-MT2-Hu-48T	DL Develop	48T	EUR 498
Should the Human Metallothionein 2 (MT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Metallothionein 2 (MT2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Metallothionein 2 (MT2) ELISA Kit
DLR-MT2-Hu-96T	DL Develop	96T	EUR 647
Should the Human Metallothionein 2 (MT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Metallothionein 2 (MT2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Metallothionein 3 (MT3) ELISA Kit
DLR-MT3-Hu-48T	DL Develop	48T	EUR 479
Should the Human Metallothionein 3 (MT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Metallothionein 3 (MT3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Metallothionein 3 (MT3) ELISA Kit
DLR-MT3-Hu-96T	DL Develop	96T	EUR 621
Should the Human Metallothionein 3 (MT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Metallothionein 3 (MT3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Metallothionein 1A(MT1A) ELISA kit
E01M0402-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein 1A(MT1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 1A(MT1A) ELISA kit
E01M0402-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein 1A(MT1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 1A(MT1A) ELISA kit
E01M0402-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein 1A(MT1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 1E(MT1E) ELISA kit
E01M0403-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein 1E(MT1E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 1E(MT1E) ELISA kit
E01M0403-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein 1E(MT1E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 1E(MT1E) ELISA kit
E01M0403-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein 1E(MT1E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 1F(MT1F) ELISA kit
E01M0404-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein 1F(MT1F) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 1F(MT1F) ELISA kit
E01M0404-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein 1F(MT1F) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 1F(MT1F) ELISA kit
E01M0404-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Metallothionein 1F(MT1F) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metallothionein 1E (MT1E) ELISA Kit
abx052400-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-10 working days.

Human Metallothionein 1 (MT1) ELISA Kit
20-abx152313	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Metallothionein 1E (MT1E) ELISA Kit
20-abx152314	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Metallothionein 2 (MT2) ELISA Kit
20-abx152316	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Metallothionein 3 (MT3) ELISA Kit
20-abx152318	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Metallothionein 1E (MT1E) ELISA Kit
abx253766-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Metallothionein 1A (MT1A) ELISA Kit
abx250530-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Metallothionein 2 (MT2) ELISA Kit
abx251296-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Metallothionein 1 (MT1) ELISA Kit
abx252780-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Metallothionein 3 (MT3) ELISA Kit
abx252783-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human MT1(Metallothionein 1) ELISA Kit
EH3388	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml Alias: MT1/Metallothionein 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human MT3(Metallothionein 3) ELISA Kit
EH3391	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P25713 Alias: MT3/Metallothionein 3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

ELISA kit for Human Metallothionein-1A
EK2781	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Metallothionein-1A in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Metallothionein-2
EK4034	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Metallothionein-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Metallothionein,MT
EK0257	SAB	96 tests	EUR 712
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Metallothionein,MT in samples from serum, plasma, tissue homogenates and other biological fluids.

Human MT1E/ Metallothionein-1E ELISA Kit
E1645Hu	Sunlong	1 Kit	EUR 571

Human MT2A/ Metallothionein-2 ELISA Kit
E1646Hu	Sunlong	1 Kit	EUR 571

Human MT1A/ Metallothionein-1A ELISA Kit
E2806Hu	Sunlong	1 Kit	EUR 571

Human MT1E(Metallothionein-1E) ELISA Kit
EH0808	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: P04732 Alias: MT1E(Metallothionein-1E)/MT-1E
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human MT1A(Metallothionein-1A) ELISA Kit
EH1269	FN Test	96T	EUR 567.6
Detection range: 1.56-100 ng/ml Uniprot ID: P04731 Alias: MT1A/Metallothionein-IA(MT-IA)/MTNR1A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human MT2A(Metallothionein-2) ELISA Kit
EH1973	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: P02795 Alias: MT2(Metallothionein-2)/MT2A/CES1/MT-2/MT-II/Metallothionein-2A/Metallothionein-II
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Metallothionein- 1F, MT1F ELISA KIT
ELI-16604h	Lifescience Market	96 Tests	EUR 824

Human Metallothionein- 1X, MT1X ELISA KIT
ELI-19359h	Lifescience Market	96 Tests	EUR 824

Human Metallothionein- 1A, MT1A ELISA KIT
ELI-03677h	Lifescience Market	96 Tests	EUR 824

Human Metallothionein- 2, MT2A ELISA KIT
ELI-05999h	Lifescience Market	96 Tests	EUR 824

Human Metallothionein- 4, MT4 ELISA KIT
ELI-42092h	Lifescience Market	96 Tests	EUR 824

Human Metallothionein- 3, MT3 ELISA KIT
ELI-46504h	Lifescience Market	96 Tests	EUR 824

Human Metallothionein 1E (MT1E) ELISA Kit
abx572565-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Metallothionein 1 (MT1) ELISA Kit
abx574447-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Metallothionein 2(MT2)ELISA Kit
GA-E1440HM-48T	GenAsia Biotech	48T	EUR 289

Human Metallothionein 2(MT2)ELISA Kit
GA-E1440HM-96T	GenAsia Biotech	96T	EUR 466

Human Metallothionein- 1G, MT1G ELISA KIT
ELI-38590h	Lifescience Market	96 Tests	EUR 824

Human Metallothionein- 1L, MT1L ELISA KIT
ELI-36664h	Lifescience Market	96 Tests	EUR 824

Human Metallothionein- 1B, MT1B ELISA KIT
ELI-37201h	Lifescience Market	96 Tests	EUR 824

Human Metallothionein- 1H, MT1H ELISA KIT
ELI-37202h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human Metallothionein (MT)
KTE61519-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Metallothionein (MT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Metallothionein (MT)
KTE61519-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Metallothionein (MT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Metallothionein (MT)
KTE61519-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Metallothionein (MT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Metallothionein 4(MT4)ELISA Kit
QY-E02756	Qayee Biotechnology	96T	EUR 361

Human Metallothionein 3(MT3)ELISA Kit
QY-E02757	Qayee Biotechnology	96T	EUR 361

Human Metallothionein 2(MT2)ELISA Kit
QY-E02758	Qayee Biotechnology	96T	EUR 361

Human Metallothionein 1X(MT1X)ELISA Kit
QY-E02759	Qayee Biotechnology	96T	EUR 361

Human Metallothionein 1L(MT1L)ELISA Kit
QY-E02761	Qayee Biotechnology	96T	EUR 361

Human Metallothionein 1H(MT1H)ELISA Kit
QY-E02762	Qayee Biotechnology	96T	EUR 361

Human Metallothionein 1G(MT1G)ELISA Kit
QY-E02763	Qayee Biotechnology	96T	EUR 361

Human Metallothionein 1F(MT1F)ELISA Kit
QY-E02764	Qayee Biotechnology	96T	EUR 361

Human Metallothionein 1E(MT1E)ELISA Kit
QY-E02765	Qayee Biotechnology	96T	EUR 361

Human Metallothionein 1B(MT1B)ELISA Kit
QY-E02766	Qayee Biotechnology	96T	EUR 374

Human Metallothionein 1(MT1)ELISA Kit
QY-E02767	Qayee Biotechnology	96T	EUR 374

Human Metallothionein 1 ELISA Kit (MT1)
RK01887	Abclonal	96 Tests	EUR 521

Human Metallothionein 3 ELISA Kit (MT3)
RK01888	Abclonal	96 Tests	EUR 521

Human Metallothionein 1E (MT1E) ELISA Kit
SED794Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 1E (MT1E) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metallothionein 1E (MT1E) in serum, plasma, tissue homogenates and other biological fluids.

Human Metallothionein 1E (MT1E) ELISA Kit
SED794Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 1E (MT1E) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metallothionein 1E (MT1E) in serum, plasma, tissue homogenates and other biological fluids.

Human Metallothionein 1E (MT1E) ELISA Kit
SED794Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 1E (MT1E) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metallothionein 1E (MT1E) in serum, plasma, tissue homogenates and other biological fluids.

Human Metallothionein 1E (MT1E) ELISA Kit
SED794Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 1E (MT1E) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metallothionein 1E (MT1E) in serum, plasma, tissue homogenates and other biological fluids.

Human Metallothionein 1E (MT1E) ELISA Kit
4-SED794Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Metallothionein 1E elisa. Alternative names of the recognized antigen: MTD
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Metallothionein 1E (MT1E) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Metallothionein 2 (MT2) ELISA Kit
SEB868Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 2 (MT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metallothionein 2 (MT2) in serum, plasma, tissue homogenates and other biological fluids.

Human Metallothionein 2 (MT2) ELISA Kit
SEB868Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 2 (MT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metallothionein 2 (MT2) in serum, plasma, tissue homogenates and other biological fluids.

Human Metallothionein 2 (MT2) ELISA Kit
SEB868Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 2 (MT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metallothionein 2 (MT2) in serum, plasma, tissue homogenates and other biological fluids.

Human Metallothionein 2 (MT2) ELISA Kit
SEB868Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 2 (MT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metallothionein 2 (MT2) in serum, plasma, tissue homogenates and other biological fluids.

Human Metallothionein 2 (MT2) ELISA Kit
4-SEB868Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Metallothionein 2 elisa. Alternative names of the recognized antigen: MT2A CES1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Metallothionein 2 (MT2) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Metallothionein 3 (MT3) ELISA Kit
SEA743Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 3 (MT3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metallothionein 3 (MT3) in serum, plasma, tissue homogenates and other biological fluids.

Human Metallothionein 3 (MT3) ELISA Kit
SEA743Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 3 (MT3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metallothionein 3 (MT3) in serum, plasma, tissue homogenates and other biological fluids.

Human Metallothionein 3 (MT3) ELISA Kit
SEA743Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 3 (MT3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metallothionein 3 (MT3) in serum, plasma, tissue homogenates and other biological fluids.

Human Metallothionein 3 (MT3) ELISA Kit
SEA743Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 3 (MT3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metallothionein 3 (MT3) in serum, plasma, tissue homogenates and other biological fluids.

Human Metallothionein 3 (MT3) ELISA Kit
4-SEA743Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Metallothionein 3 elisa. Alternative names of the recognized antigen: GIF GIFB GRIF Growth Inhibitory Factor Neurotrophic
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Metallothionein 3 (MT3) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Metallothionein 1 (MT1) ELISA Kit
SEB119Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metallothionein 1 (MT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metallothionein 1 (MT1) in serum, plasma, tissue homogenates and other biological fluids.

Human MT1M(Metallothionein 1M) ELISA Kit