Human NEUROD6(Neurogenic Differentiation 6) ELISA Kit

Human NEUROD6(Neurogenic Differentiation 6) ELISA Kit

To Order: Contact us

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit

RD-NEUROD6-Hu-48Tests 48 Tests
EUR 521

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit

RD-NEUROD6-Hu-96Tests 96 Tests
EUR 723

Human Neurogenic Differentiation 6 (NEUROD6)ELISA Kit

201-12-2924 96 tests
EUR 440
  • This Neurogenic Differentiation 6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neurogenic Differentiation 6(NEUROD6)ELISA Kit

QY-E01620 96T
EUR 361

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit

SEH552Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogenic Differentiation 6 (NEUROD6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurogenic Differentiation 6 (NEUROD6) in Tissue homogenates and other biological fluids.

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit

SEH552Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogenic Differentiation 6 (NEUROD6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurogenic Differentiation 6 (NEUROD6) in Tissue homogenates and other biological fluids.

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit

SEH552Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogenic Differentiation 6 (NEUROD6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurogenic Differentiation 6 (NEUROD6) in Tissue homogenates and other biological fluids.

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit

SEH552Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogenic Differentiation 6 (NEUROD6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurogenic Differentiation 6 (NEUROD6) in Tissue homogenates and other biological fluids.

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurogenic Differentiation 6 elisa. Alternative names of the recognized antigen: Atoh2
  • NEX1M
  • Math-2
  • bHLHa2
  • Neurogenic differentiation factor 6
  • Mammalian Atonal Homolog 2
  • Atonal Homolog 2
  • Class A basic helix-loop-helix protein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neurogenic Differentiation 6 (NEUROD6) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Neurogenic Differentiation 6 (NEUROD6) Antibody

abx027415-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neurogenic Differentiation 6 (NEUROD6) Antibody

abx027415-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neurogenic Differentiation 6 (NEUROD6) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neurogenic Differentiation 6 (NEUROD6) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurogenic Differentiation 6 (NEUROD6) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neurogenic Differentiation 6 (NEUROD6) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Neurogenic Differentiation 6 (NEUROD6) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1957.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Neurogenic Differentiation 6 (NEUROD6) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Neurogenic differentiation factor 6, NEUROD6 ELISA KIT

ELI-20076h 96 Tests
EUR 824

ELISA kit for Human NEUROD6 (Neurogenic Differentiation 6)

ELK3348 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurogenic Differentiation 6 (NEUROD6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
  • Show more
Description: A sandwich ELISA kit for detection of Neurogenic Differentiation 6 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Neurogenic Differentiation 6 (NEUROD6) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurogenic Differentiation 6 (NEUROD6) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurogenic Differentiation 6 (NEUROD6) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Neurogenic differentiation factor 6, Neurod6 ELISA KIT

ELI-13188m 96 Tests
EUR 865

Bovine Neurogenic differentiation factor 6, NEUROD6 ELISA KIT

ELI-46036b 96 Tests
EUR 928

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6)

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with APC.

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with Biotin.

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with Cy3.

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with FITC.

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with HRP.

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with PE.

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with APC-Cy7.

Human Neurogenic Differentiation 1 (NEUROD1)ELISA Kit

201-12-2921 96 tests
EUR 440
  • This Neurogenic Differentiation 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Neurogenic Differentiation 2 (NEUROD2)ELISA Kit

201-12-2922 96 tests
EUR 440
  • This Neurogenic Differentiation 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Neurogenic Differentiation 4 (NEUROD4)ELISA Kit

201-12-2923 96 tests
EUR 440
  • This Neurogenic Differentiation 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Neurogenic Differentiation 4(NEUROD4)ELISA Kit

QY-E01621 96T
EUR 413

Human Neurogenic Differentiation 2(NEUROD2)ELISA Kit

QY-E01622 96T
EUR 413

Human Neurogenic Differentiation 1(NEUROD1)ELISA Kit

QY-E01623 96T
EUR 413

Human Neurogenic differentiation factor 1, NEUROD1 ELISA KIT

ELI-44083h 96 Tests
EUR 824

Human Neurogenic differentiation factor 2, NEUROD2 ELISA KIT

ELI-44693h 96 Tests
EUR 824

Human Neurogenic differentiation factor 4, NEUROD4 ELISA KIT

ELI-46035h 96 Tests
EUR 824

Neurogenic Differentiation Factor 2 (NEUROD2) ELISA Kit

abx595865-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Recombinant human Neurogenic differentiation factor 4

P2216 100ug Ask for price
  • Uniprot ID: Q9HD90
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Neurogenic differentiation factor 4

Mouse Neurogenic differentiation factor 1, Neurod1 ELISA KIT

ELI-23025m 96 Tests
EUR 865

Mouse Neurogenic differentiation factor 2, Neurod2 ELISA KIT

ELI-23026m 96 Tests
EUR 865

Mouse Neurogenic differentiation factor 4, Neurod4 ELISA KIT

ELI-23027m 96 Tests
EUR 865

NEUROD1 ELISA Kit| chicken Neurogenic differentiation factor 1

EF012424 96 Tests
EUR 689

Chicken Neurogenic differentiation factor 4, NEUROD4 ELISA KIT

ELI-44084c 96 Tests
EUR 928

Chicken Neurogenic differentiation factor 1, NEUROD1 ELISA KIT

ELI-44691c 96 Tests
EUR 928

Neurogenic Differentiation 1 (NEUROD1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neurod1 ELISA Kit| Rat Neurogenic differentiation factor 1 ELIS

EF019053 96 Tests
EUR 689

Neurod1 ELISA Kit| Mouse Neurogenic differentiation factor 1 EL

EF015664 96 Tests
EUR 689

NEUROD6 ELISA Kit (Human) (OKCD09064)

OKCD09064 96 Wells
EUR 975
Description: Description of target: NEUROD6 contains 1 basic helix-loop-helix (bHLH) domain. It activates E box-dependent transcription in collaboration with TCF3/E47 and may be a trans-acting factor involved in the development and maintenance of the mammalian nervous system. It transactivates the promoter of its own gene.NEUROD6 is a member of the NEUROD (NEUROD1; MIM 601724) family of basic helix-loop-helix (bHLH) transcription factors (Guo et al., 2002.)...;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

NEUROD6 ELISA Kit (Human) (OKDD00423)

OKDD00423 96 Wells
EUR 975
Description: Description of target: This gene is a member of the NEUROD family of basic helix-loop-helix transcription factors. The encoded protein may be involved in the development and differentiation of the nervous system.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL

Neurogenic Differentiation Factor 2 (NEUROD2) Antibody

abx011246-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Human Growth Differentiation Factor 6 ELISA kit

E01G0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Growth Differentiation Factor 6 ELISA kit

E01G0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Growth Differentiation Factor 6 ELISA kit

E01G0139-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Individual Reaction Mix 6

G065-6 200 reactions
EUR 167

Human cluster of differentiation 6(CD6) ELISA kit

E01C1491-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human cluster of differentiation 6(CD6) ELISA kit

E01C1491-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human cluster of differentiation 6(CD6) ELISA kit

E01C1491-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Growth Differentiation Factor 6 (GDF6) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Growth Differentiation Factor 6 (GDF6) ELISA Kit

abx252525-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human GDF6(Growth Differentiation Factor 6) ELISA Kit

EH3127 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q6KF10
  • Alias: GDF6/BMP-13/BMP13/CDMP2/GDF16/GDF-6/growth differentiation factor 6/Growth/differentiation factor 16/growth/differentiation factor 6/KFS/KFS1/KFSL/MCOP4/MCOPCB6/MGC158100/MGC158101/SCDO4/SGM1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Growth/differentiation factor 6, GDF6 ELISA KIT

ELI-12531h 96 Tests
EUR 824

Human Growth/differentiation factor 6(GDF6) ELISA kit

CSB-EL009350HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Growth/differentiation factor 6 (GDF6) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Growth/differentiation factor 6(GDF6) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Growth/differentiation factor 6(GDF6) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human cluster of differentiation 6(CD6) ELISA Kit

CSB-E17494h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human cluster of differentiation 6 (CD6) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human cluster of differentiation 6(CD6) ELISA Kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human cluster of differentiation 6(CD6) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Cluster of Differentiation 6 (CD6) ELISA Kit

abx514435-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Growth Differentiation Factor 6 (GDF6) ELISA Kit

SEC111Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Growth Differentiation Factor 6 (GDF6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Growth Differentiation Factor 6 (GDF6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Growth Differentiation Factor 6 (GDF6) ELISA Kit

SEC111Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Growth Differentiation Factor 6 (GDF6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Growth Differentiation Factor 6 (GDF6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Growth Differentiation Factor 6 (GDF6) ELISA Kit

SEC111Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Growth Differentiation Factor 6 (GDF6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Growth Differentiation Factor 6 (GDF6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Growth Differentiation Factor 6 (GDF6) ELISA Kit

SEC111Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Growth Differentiation Factor 6 (GDF6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Growth Differentiation Factor 6 (GDF6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Growth Differentiation Factor 6 (GDF6) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Growth Differentiation Factor 6 elisa. Alternative names of the recognized antigen: BMP13
  • CDMP2
  • GDF16
  • Bone morphogenetic protein 13
  • Growth/differentiation factor 16
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Growth Differentiation Factor 6 (GDF6) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Random Nanofibers 6 Well Plate

3D00006-6 700 nm-PCLs
EUR 93

Aligned Nanofibers 6 Well Plate

3D00012-6 700 nm-PCLs
EUR 97

pLenti-CLDN1 shRNA-6 Plasmid

PVTBAV04867-6 2 ug
EUR 356

Mouse IL-6 Recombinant Protein

R00102-6 5ug/vial
EUR 259
Description: Interleukin-6 (IL-6) is an interleukin that acts as both a pro-inflammatory and anti-inflammatory cytokine. Mouse IL-6 Recombinant Protein is purified interleukin-6 produced in yeast.

Tissue Culture Plate, 6 Well

TCP20-6 1 UNIT
EUR 53.48
  • Product category: Labware/Culture Related/Culture Plates - Multiwell

NEUROD6 Antibody

44673-100ul 100ul
EUR 252

NEUROD6 Antibody

44673-50ul 50ul
EUR 187

NEUROD6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEUROD6. Recognizes NEUROD6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

NEUROD6 Antibody

DF2216 200ul
EUR 304
Description: NEUROD6 antibody detects endogenous levels of total NEUROD6.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEUROD6 Antibody

ABD2216 100 ug
EUR 438

ExoStd? Lyophilized Exosome Standard (30 µg, Human Plasma, 6 vials)

EUR 1300

ExoStd? Lyophilized Exosome Standard (100 µg, Human Plasma, 6 vials)

EUR 1572

ExoStd? Lyophilized Exosome Standard (30 µg, Human Serum, 6 vials)

EUR 1300

ExoStd? Lyophilized Exosome Standard (100 µg, Human Serum, 6 vials)

EUR 1572

ExoStd? Lyophilized Exosome Standard (30 µg, Human Urine, 6 vials)

EUR 1289

ExoStd? Lyophilized Exosome Standard (100 µg, Human Urine, 6 vials)

EUR 1572

ExoStd? Lyophilized Exosome Standard (30 µg, Human Saliva, 6 vials)

EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, Human Saliva, 6 vials)

EUR 1621

Rat Growth Differentiation Factor 6 ELISA kit

E02G0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Growth Differentiation Factor 6 ELISA kit

E02G0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Growth Differentiation Factor 6 ELISA kit

E02G0139-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Growth Differentiation Factor 6 ELISA kit

E03G0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Growth Differentiation Factor 6 ELISA kit

E03G0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Growth Differentiation Factor 6 ELISA kit

E03G0139-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Growth Differentiation Factor 6 ELISA kit

E04G0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Growth Differentiation Factor 6 ELISA kit

E04G0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Growth Differentiation Factor 6 ELISA kit

E04G0139-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Growth Differentiation Factor 6 ELISA kit

E06G0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Growth Differentiation Factor 6 ELISA kit

E06G0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Growth Differentiation Factor 6 ELISA kit

E06G0139-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Growth Differentiation Factor 6 ELISA kit

E09G0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Growth Differentiation Factor 6 ELISA kit

E09G0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Growth Differentiation Factor 6 ELISA kit

E09G0139-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Growth Differentiation Factor 6 ELISA kit

E08G0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Growth Differentiation Factor 6 ELISA kit

E08G0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Growth Differentiation Factor 6 ELISA kit

E08G0139-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Growth Differentiation Factor 6 ELISA kit

E07G0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Growth Differentiation Factor 6 ELISA kit

E07G0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Growth Differentiation Factor 6 ELISA kit

E07G0139-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Aligned Nanofibers 6 Well Plate Inserts

3D00016-6 700 nm-PCLs
EUR 98

ELISA kit for Human GDF6 (Growth Differentiation Factor 6)

E-EL-H1912 1 plate of 96 wells
EUR 534
  • Gentaur's GDF6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GDF6. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GDF6 (Growth Differentiation Factor 6) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GDF6 (Growth Differentiation Factor 6)

ELK4974 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Growth Differentiation Factor 6 (GDF6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
  • Show more
Description: A sandwich ELISA kit for detection of Growth Differentiation Factor 6 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human NEUROD6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEUROD6 Recombinant Protein (Human)

RP021097 100 ug Ask for price

AFP (Alpha fetoprotein) ELISA test

6 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of AFP (Alpha fetoprotein)

Rat cluster of differentiation 6(CD6) ELISA kit

E02C1491-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat cluster of differentiation 6(CD6) ELISA kit

E02C1491-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat cluster of differentiation 6(CD6) ELISA kit

E02C1491-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Growth Differentiation Factor 6 ELISA kit

E05G0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Growth Differentiation Factor 6 ELISA kit

E05G0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Growth Differentiation Factor 6 ELISA kit

E05G0139-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat cluster of differentiation 6(CD6) ELISA kit

E06C1491-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat cluster of differentiation 6(CD6) ELISA kit

E06C1491-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat cluster of differentiation 6(CD6) ELISA kit

E06C1491-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cluster of differentiation 6(CD6) ELISA kit

E04C1491-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cluster of differentiation 6(CD6) ELISA kit

E04C1491-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cluster of differentiation 6(CD6) ELISA kit

E04C1491-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cluster of differentiation 6(CD6) ELISA kit

E03C1491-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cluster of differentiation 6(CD6) ELISA kit

E03C1491-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cluster of differentiation 6(CD6) ELISA kit

E03C1491-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cluster of differentiation 6(CD6) ELISA kit

E07C1491-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cluster of differentiation 6(CD6) ELISA kit

E07C1491-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cluster of differentiation 6(CD6) ELISA kit

E07C1491-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Growth Differentiation Factor 6 (GDF6) ELISA Kit

abx254118-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Growth Differentiation Factor 6 (GDF6) ELISA Kit

abx256955-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Monkey cluster of differentiation 6(CD6) ELISA kit

E09C1491-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey cluster of differentiation 6(CD6) ELISA kit

E09C1491-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey cluster of differentiation 6(CD6) ELISA kit

E09C1491-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cluster of differentiation 6(CD6) ELISA kit

E08C1491-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cluster of differentiation 6(CD6) ELISA kit

E08C1491-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cluster of differentiation 6(CD6) ELISA kit

E08C1491-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Growth/differentiation factor 6, Gdf6 ELISA KIT

ELI-31265m 96 Tests
EUR 865

Bovine Growth/differentiation factor 6, GDF6 ELISA KIT

ELI-26549b 96 Tests
EUR 928

Canine cluster of differentiation 6,CD6 ELISA Kit

CN-00926C1 96T
EUR 471

Canine cluster of differentiation 6,CD6 ELISA Kit

CN-00926C2 48T
EUR 322

Mouse cluster of differentiation 6(CD6) ELISA Kit

CSB-EL004949MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Mouse cluster of differentiation 6 (CD6) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse cluster of differentiation 6(CD6) ELISA Kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Mouse cluster of differentiation 6(CD6) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig Growth Differentiation Factor 6 (GDF6) ELISA Kit

abx360522-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Growth Differentiation Factor 6 (GDF6) ELISA Kit

abx363095-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Cluster of Differentiation 6 (CD6) ELISA Kit

abx353582-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Chicken Growth Differentiation Factor 6 (GDF6) ELISA Kit

abx356607-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Growth Differentiation Factor 6 (GDF6) ELISA Kit

abx358914-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Cluster of Differentiation 6 (CD6) ELISA Kit

abx514436-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse GDF6(Growth Differentiation Factor 6) ELISA Kit

EM1067 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P43028
  • Alias: GDF6/BMP-13/BMP13/CDMP2/GDF16/GDF-6/growth differentiation factor 6/Growth/differentiation factor 16/growth/differentiation factor 6/KFS/KFS1/KFSL/MCOP4/MCOPCB6/MGC158100/MGC158101/SCDO4/SGM1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml

Rat GDF6(Growth Differentiation Factor 6) ELISA Kit

ER0989 96T
EUR 524.1
  • Detection range: 1.563-100 ng/ml
  • Uniprot ID: Q6HA10
  • Alias: GDF6/BMP-13/BMP13/CDMP2/GDF16/GDF-6/growth differentiation factor 6/Growth/differentiation factor 16/growth/differentiation factor 6/KFS/KFS1/KFSL/MCOP4/MCOPCB6/MGC158100/MGC158101/SCDO4/SGM1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.938 ng/ml

Canine Cluster Of Differentiation 6(CD6)ELISA Kit

GA-E0055CN-48T 48T
EUR 402

Canine Cluster Of Differentiation 6(CD6)ELISA Kit

GA-E0055CN-96T 96T
EUR 684

Canine cluster of differentiation 6,CD6 ELISA Kit

QY-E70061 96T
EUR 426

GDF6 ELISA Kit| Rat Growth Differentiation Factor 6 ELISA Kit

EF017761 96 Tests
EUR 689

GDF6 ELISA Kit| Mouse Growth Differentiation Factor 6 ELISA Kit

EF013635 96 Tests
EUR 689

NEUROD6 Rabbit pAb

A15881-100ul 100 ul
EUR 308

NEUROD6 Rabbit pAb

A15881-200ul 200 ul
EUR 459

NEUROD6 Rabbit pAb

A15881-20ul 20 ul
EUR 183

NEUROD6 Rabbit pAb

A15881-50ul 50 ul
EUR 223

NEUROD6 Blocking Peptide

DF2216-BP 1mg
EUR 195

NEUROD6 Conjugated Antibody

C44673 100ul
EUR 397

NEUROD6 cloning plasmid

CSB-CL846677HU-10ug 10ug
EUR 394
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1014
  • Sequence: atgttaacactaccgtttgatgagtctgttgtaatgccagaatcccagatgtgcagaaagttttctagagaatgcgaggaccagaagcaaattaagaagccagaaagcttttccaaacagattgtccttcgaggaaagagcatcaaaagggcccctggagaagaaaccgagaaag
  • Show more
Description: A cloning plasmid for the NEUROD6 gene.

Anti-NEUROD6 antibody

STJ118340 100 µl
EUR 277

Anti-NEUROD6 (4G11)

YF-MA20575 200 ul
EUR 363
Description: Mouse monoclonal to NEUROD6

Anti-NEUROD6 (1B5)

YF-MA20576 200 ul
EUR 363
Description: Mouse monoclonal to NEUROD6

ExoStd? Lyophilized Exosome Standard (30 µg, U87 MG, 6 vials)

EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, U87 MG, 6 vials)

EUR 1616

Human Growth Differentiation Factor 6 (GDF6) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Recombinant human Growth/differentiation factor 6

P1871 100ug Ask for price
  • Uniprot ID: Q6KF10
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Growth/differentiation factor 6

ExoStd? Lyophilized Exosome Standard (30 µg, COLO1 cell line, 6 vials)

EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, COLO1 cell line, 6 vials)

EUR 1616

ExoStd? Lyophilized Exosome Standard (30 µg, MM1 cell line, 6 vials)

EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, MM1 cell line, 6 vials)

EUR 1616

ExoStd? Lyophilized Exosome Standard (30 µg, BLCL21 cell line, 6 vials)

EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, BLCL21 cell line, 6 vials)

EUR 1572

ExoStd? Lyophilized Exosome Standard (30 µg, HCT116 cell line, 6 vials)

EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, HCT116 cell line, 6 vials)

EUR 1616

ExoStd? Lyophilized Exosome Standard (30 µg, PC3 cell line, 6 vials)

EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, PC3 cell line, 6 vials)

EUR 1616

ExoStd? Lyophilized Exosome Standard (30 µg, DAUD1 cell line, 6 vials)

EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, DAUD1 cell line, 6 vials)

EUR 1616

ExoStd? Lyophilized Exosome Standard (30 µg, A549 cell line, 6 vials)

EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, A549 cell line, 6 vials)

EUR 1616

ExoStd? Lyophilized Exosome Standard (30 µg, B16F10 cell line, 6 vials)

EUR 1306

ExoStd? Lyophilized Exosome Standard (1090 µg, B16F10 cell line, 6 vials)

EUR 1616

NEUROD6 ORF Vector (Human) (pORF)

ORF007033 1.0 ug DNA
EUR 95

ExoStd? Lyophilized Exosome Standard (30 µg, BPH-1 cell line, 6 vials)

EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, BPH-1 cell line, 6 vials)

EUR 1616

ExoStd? Lyophilized Exosome Standard (30 µg, K-562 cell line, 6 vials)

EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, K-562 cell line, 6 vials)

EUR 1616

ELISA kit for Mouse GDF6 (Growth Differentiation Factor 6)

E-EL-M1271 1 plate of 96 wells
EUR 534
  • Gentaur's GDF6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse GDF6. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse GDF6 (Growth Differentiation Factor 6) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat CD6 (Cluster of Differentiation 6)

E-EL-R0218 1 plate of 96 wells
EUR 534
  • Gentaur's CD6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CD6. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat CD6 (Cluster of Differentiation 6) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat GDF6 (Growth Differentiation Factor 6)

E-EL-R1089 1 plate of 96 wells
EUR 534
  • Gentaur's GDF6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat GDF6. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat GDF6 (Growth Differentiation Factor 6) in samples from Serum, Plasma, Cell supernatant

Guinea pig cluster of differentiation 6(CD6) ELISA kit

E05C1491-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig cluster of differentiation 6(CD6) ELISA kit

E05C1491-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig cluster of differentiation 6(CD6) ELISA kit

E05C1491-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Growth Differentiation Factor 6 (GDF6) ELISA Kit

abx357877-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ExoStd? Lyophilized Exosome Standard (30 µg, SK-N-SH cell line, 6 vials)

EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, SK-N-SH cell line, 6 vials)

EUR 1616

Human cluster of differentiation 44 variant 6(CD44 v6) ELISA kit

E01C1486-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human cluster of differentiation 44 variant 6(CD44 v6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human cluster of differentiation 44 variant 6(CD44 v6) ELISA kit

E01C1486-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human cluster of differentiation 44 variant 6(CD44 v6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human cluster of differentiation 44 variant 6(CD44 v6) ELISA kit

E01C1486-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human cluster of differentiation 44 variant 6(CD44 v6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Cluster Of Differentiation 6 (CD6) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2026.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human NEUROD6(Neurogenic Differentiation 6) ELISA Kit