Human NEXN(Nexilin) ELISA Kit

Human NEXN(Nexilin) ELISA Kit

To Order: Contact us

Human Nexilin (NEXN) ELISA Kit
RDR-NEXN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Nexilin (NEXN) ELISA Kit
RD-NEXN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Nexilin (NEXN) ELISA Kit
RD-NEXN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Nexilin (NEXN) ELISA Kit
20-abx152514	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Nexilin, NEXN ELISA KIT
ELI-23617h	Lifescience Market	96 Tests	EUR 824

Human Nexilin(NEXN)ELISA Kit
QY-E04760	Qayee Biotechnology	96T	EUR 361

Human Nexilin (NEXN) ELISA Kit
SEH548Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

Human Nexilin (NEXN) ELISA Kit
SEH548Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

Human Nexilin (NEXN) ELISA Kit
SEH548Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

Human Nexilin (NEXN) ELISA Kit
SEH548Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

Human Nexilin (NEXN) ELISA Kit
4-SEH548Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Nexilin elisa. Alternative names of the recognized antigen: NELIN F Actin Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Nexilin (NEXN) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Nexilin, Nexn ELISA KIT
ELI-44726m	Lifescience Market	96 Tests	EUR 865

for Nexilin (NEXN)ELISA kit
SEH548Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	Ask for price
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit
SEH548Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	Ask for price
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit
SEH548Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	Ask for price
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit
SEH548Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	Ask for price
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

ELISA Kit for Nexilin (NEXN)
4-SEH548Mu	Cloud-Clone	Ask for price Ask for price Ask for price	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Nexilin elisa. Alternative names of the recognized antigen: NELIN F Actin Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Nexilin (NEXN) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

for Nexilin (NEXN)ELISA kit
SEH548Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit
SEH548Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit
SEH548Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit
SEH548Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

ELISA Kit for Nexilin (NEXN)
4-SEH548Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Nexilin elisa. Alternative names of the recognized antigen: NELIN F Actin Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Nexilin (NEXN) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Nexilin (NEXN) Antibody
20-abx177803	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Nexilin (NEXN) Antibody
20-abx100201	Abbexa	EUR 328.00 EUR 133.00 EUR 871.00 EUR 453.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Nexilin (NEXN) Antibody
20-abx129329	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Nexilin (NEXN) Antibody
20-abx173818	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Nexilin (NEXN)
4-RPH548Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q7TPW1 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 51.7kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Nexilin expressed in: E.coli

Recombinant Nexilin (NEXN)
4-RPH548Ra01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9Z2J4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.1kDa Isoelectric Point: Inquire
Description: Recombinant Rat Nexilin expressed in: E.coli

ELISA kit for Human NEXN (Nexilin)
ELK3367	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nexilin (NEXN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nexilin (NEXN). Nex Show more
Description: A sandwich ELISA kit for detection of Nexilin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Nexilin (NEXN)
KTE62219-48T	Abbkine	48T	EUR 332
The name nexilin came from the Latin word nexilis, meaning 'bound together.' Full-length b-nexilin contains an N-terminal F-actin-binding domain (ABD), followed by a spacer, a coiled-coil region, a second ABD, and a long C-terminal tail. In compariso Show more
Description: Quantitative sandwich ELISA for measuring Human Nexilin (NEXN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nexilin (NEXN)
KTE62219-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The name nexilin came from the Latin word nexilis, meaning 'bound together.' Full-length b-nexilin contains an N-terminal F-actin-binding domain (ABD), followed by a spacer, a coiled-coil region, a second ABD, and a long C-terminal tail. In compariso Show more
Description: Quantitative sandwich ELISA for measuring Human Nexilin (NEXN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nexilin (NEXN)
KTE62219-96T	Abbkine	96T	EUR 539
The name nexilin came from the Latin word nexilis, meaning 'bound together.' Full-length b-nexilin contains an N-terminal F-actin-binding domain (ABD), followed by a spacer, a coiled-coil region, a second ABD, and a long C-terminal tail. In compariso Show more
Description: Quantitative sandwich ELISA for measuring Human Nexilin (NEXN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Nexilin (NEXN) CLIA Kit
20-abx495472	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Nexilin (NEXN) Protein
20-abx654557	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Nexilin (NEXN) Protein
20-abx167347	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Nexilin (NEXN) Protein
20-abx068288	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Nexilin (NEXN) Polyclonal Antibody (Mouse)
4-PAH548Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (His421~Tyr607) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN)

Nexilin (NEXN) Polyclonal Antibody (Rat)
4-PAH548Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (Ala214~Gln455) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN)

Nexilin (NEXN) Polyclonal Antibody (Mouse), APC
4-PAH548Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (His421~Tyr607) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with APC.

Nexilin (NEXN) Polyclonal Antibody (Mouse), Biotinylated
4-PAH548Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (His421~Tyr607) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with Biotin.

Nexilin (NEXN) Polyclonal Antibody (Mouse), Cy3
4-PAH548Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (His421~Tyr607) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with Cy3.

Nexilin (NEXN) Polyclonal Antibody (Mouse), FITC
4-PAH548Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (His421~Tyr607) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with FITC.

Nexilin (NEXN) Polyclonal Antibody (Mouse), HRP
4-PAH548Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (His421~Tyr607) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with HRP.

Nexilin (NEXN) Polyclonal Antibody (Mouse), PE
4-PAH548Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (His421~Tyr607) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with PE.

Nexilin (NEXN) Polyclonal Antibody (Rat), APC
4-PAH548Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (Ala214~Gln455) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with APC.

Nexilin (NEXN) Polyclonal Antibody (Rat), Biotinylated
4-PAH548Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (Ala214~Gln455) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with Biotin.

Nexilin (NEXN) Polyclonal Antibody (Rat), Cy3
4-PAH548Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (Ala214~Gln455) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with Cy3.

Nexilin (NEXN) Polyclonal Antibody (Rat), FITC
4-PAH548Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (Ala214~Gln455) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with FITC.

Nexilin (NEXN) Polyclonal Antibody (Rat), HRP
4-PAH548Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (Ala214~Gln455) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with HRP.

Nexilin (NEXN) Polyclonal Antibody (Rat), PE
4-PAH548Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (Ala214~Gln455) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with PE.

Nexilin (NEXN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH548Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (His421~Tyr607) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with APC-Cy7.

Nexilin (NEXN) Polyclonal Antibody (Rat), APC-Cy7
4-PAH548Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NEXN (Ala214~Gln455) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with APC-Cy7.

Nexn/ Rat Nexn ELISA Kit
ELI-38298r	Lifescience Market	96 Tests	EUR 886

Human NEXN-AS1 ELISA KIT
ELI-36728h	Lifescience Market	96 Tests	EUR 824

NEXN ELISA Kit (Human) (OKCD01960)
OKCD01960	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Involved in regulating cell migration through association with the actin cytoskeleton. Has an essential role in the maintenance of Z line and sarcomere integrity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.1 pg/mL

Nexilin antibody
70R-2949	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Nexilin antibody

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Nexilin Blocking Peptide
33R-2372	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEXN antibody, catalog no. 70R-2949

NEXN siRNA
20-abx903538	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NEXN siRNA
20-abx925786	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NEXN siRNA
20-abx925787	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human NEXN shRNA Plasmid
20-abx964057	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NEXN Recombinant Protein (Human)
RP041629	ABM	100 ug	Ask for price

NEXN Polyclonal Antibody
27912-100ul	SAB	100ul	EUR 252

NEXN Polyclonal Antibody
27912-50ul	SAB	50ul	EUR 187

NEXN Rabbit pAb
A13136-100ul	Abclonal	100 ul	EUR 308

NEXN Rabbit pAb
A13136-200ul	Abclonal	200 ul	EUR 459

NEXN Rabbit pAb
A13136-20ul	Abclonal	20 ul	EUR 183

NEXN Rabbit pAb
A13136-50ul	Abclonal	50 ul	EUR 223

NEXN cloning plasmid
CSB-CL605897HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1704 Sequence: ATGGAGAAACAAAGACAAGAGGAACAAAGGAAGAGAACGGAGGAGGAACGAAAACGCAGAATTGAGCAGGATATGTTAGAAAAGAGGAAAATACAGCGTGAATTAGCAAAAAGGGCTGAACAGATTGAGGACATAAACAATACGGGAACTGAATCAGCATCAGAGGAAGGAGATG Show more
Description: A cloning plasmid for the NEXN gene.

Anti-NEXN antibody
STJ115102	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a filamentous actin-binding protein that may function in cell adhesion and migration. Mutations in this gene have been associated with dilated cardiomyopathy, also known as CMD1CC. Alternatively spliced transcript variants have been described.

NEXN ORF Vector (Human) (pORF)
ORF013877	ABM	1.0 ug DNA	EUR 354

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Rat NEXN shRNA Plasmid
20-abx987943	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse NEXN shRNA Plasmid
20-abx976746	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NEXN Polyclonal Conjugated Antibody
C27912	SAB	100ul	EUR 397

NEXN Recombinant Protein (Mouse)
RP153788	ABM	100 ug	Ask for price

NEXN Recombinant Protein (Rat)
RP213755	ABM	100 ug	Ask for price

NEXN Recombinant Protein (Rat)
RP213758	ABM	100 ug	Ask for price

NEXN sgRNA CRISPR Lentivector set (Human)
K1419901	ABM	3 x 1.0 ug	EUR 339

NEXN-AS1 ORF Vector (Human) (pORF)
ORF026058	ABM	1.0 ug DNA	Ask for price

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Nexn ORF Vector (Rat) (pORF)
ORF071253	ABM	1.0 ug DNA	EUR 506

Human NEXN(Nexilin) ELISA Kit