Human NEXN(Nexilin) ELISA Kit

Human NEXN(Nexilin) ELISA Kit

To Order: Contact us

Human Nexilin (NEXN) ELISA Kit
RD-NEXN-Hu-96Tests 96 Tests
EUR 723

Human Nexilin (NEXN) ELISA Kit
RDR-NEXN-Hu-48Tests 48 Tests
EUR 544

Human Nexilin (NEXN) ELISA Kit
RDR-NEXN-Hu-96Tests 96 Tests
EUR 756

Human Nexilin, NEXN ELISA KIT
ELI-23617h 96 Tests
EUR 824

Human Nexilin (NEXN) ELISA Kit
20-abx152514
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Nexilin(NEXN)ELISA Kit
QY-E04760 96T
EUR 361

Human Nexilin (NEXN) ELISA Kit
SEH548Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

Human Nexilin (NEXN) ELISA Kit
SEH548Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

Human Nexilin (NEXN) ELISA Kit
SEH548Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

Human Nexilin (NEXN) ELISA Kit
SEH548Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

Human Nexilin (NEXN) ELISA Kit
4-SEH548Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Nexilin elisa. Alternative names of the recognized antigen: NELIN
  • F Actin Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Nexilin (NEXN) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Nexilin, Nexn ELISA KIT
ELI-44726m 96 Tests
EUR 865

for Nexilin (NEXN)ELISA kit
SEH548Mu-10x96wellstestplate 10x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit
SEH548Mu-1x48wellstestplate 1x48-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit
SEH548Mu-1x96wellstestplate 1x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit
SEH548Mu-5x96wellstestplate 5x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

ELISA Kit for Nexilin (NEXN)
4-SEH548Mu
  • Ask for price
  • Ask for price
  • Ask for price
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Nexilin elisa. Alternative names of the recognized antigen: NELIN
  • F Actin Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Nexilin (NEXN) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

for Nexilin (NEXN)ELISA kit
SEH548Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit
SEH548Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit
SEH548Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit
SEH548Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

ELISA Kit for Nexilin (NEXN)
4-SEH548Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Nexilin elisa. Alternative names of the recognized antigen: NELIN
  • F Actin Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Nexilin (NEXN) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Nexilin (NEXN) Antibody
20-abx129329
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nexilin (NEXN) Antibody
20-abx100201
  • EUR 328.00
  • EUR 133.00
  • EUR 871.00
  • EUR 453.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nexilin (NEXN) Antibody
20-abx173818
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nexilin (NEXN) Antibody
20-abx177803
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Recombinant Nexilin (NEXN)
4-RPH548Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q7TPW1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Nexilin expressed in: E.coli

Recombinant Nexilin (NEXN)
4-RPH548Ra01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Z2J4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Nexilin expressed in: E.coli

ELISA kit for Human NEXN (Nexilin)
ELK3367 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nexilin (NEXN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nexilin (NEXN). Nex
  • Show more
Description: A sandwich ELISA kit for detection of Nexilin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Nexilin (NEXN)
KTE62219-48T 48T
EUR 332
  • The name nexilin came from the Latin word nexilis, meaning 'bound together.' Full-length b-nexilin contains an N-terminal F-actin-binding domain (ABD), followed by a spacer, a coiled-coil region, a second ABD, and a long C-terminal tail. In compariso
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Nexilin (NEXN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nexilin (NEXN)
KTE62219-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The name nexilin came from the Latin word nexilis, meaning 'bound together.' Full-length b-nexilin contains an N-terminal F-actin-binding domain (ABD), followed by a spacer, a coiled-coil region, a second ABD, and a long C-terminal tail. In compariso
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Nexilin (NEXN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nexilin (NEXN)
KTE62219-96T 96T
EUR 539
  • The name nexilin came from the Latin word nexilis, meaning 'bound together.' Full-length b-nexilin contains an N-terminal F-actin-binding domain (ABD), followed by a spacer, a coiled-coil region, a second ABD, and a long C-terminal tail. In compariso
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Nexilin (NEXN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Nexilin (NEXN) CLIA Kit
20-abx495472
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Nexilin (NEXN) Protein
20-abx654557
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Nexilin (NEXN) Protein
20-abx068288
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Nexilin (NEXN) Protein
20-abx167347
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nexilin (NEXN) Polyclonal Antibody (Mouse)
4-PAH548Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN)

Nexilin (NEXN) Polyclonal Antibody (Rat)
4-PAH548Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN)

Nexilin (NEXN) Polyclonal Antibody (Mouse), APC
4-PAH548Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with APC.

Nexilin (NEXN) Polyclonal Antibody (Mouse), Biotinylated
4-PAH548Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with Biotin.

Nexilin (NEXN) Polyclonal Antibody (Mouse), Cy3
4-PAH548Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with Cy3.

Nexilin (NEXN) Polyclonal Antibody (Mouse), FITC
4-PAH548Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with FITC.

Nexilin (NEXN) Polyclonal Antibody (Mouse), HRP
4-PAH548Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with HRP.

Nexilin (NEXN) Polyclonal Antibody (Mouse), PE
4-PAH548Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with PE.

Nexilin (NEXN) Polyclonal Antibody (Rat), APC
4-PAH548Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with APC.

Nexilin (NEXN) Polyclonal Antibody (Rat), Biotinylated
4-PAH548Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with Biotin.

Nexilin (NEXN) Polyclonal Antibody (Rat), Cy3
4-PAH548Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with Cy3.

Nexilin (NEXN) Polyclonal Antibody (Rat), FITC
4-PAH548Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with FITC.

Nexilin (NEXN) Polyclonal Antibody (Rat), HRP
4-PAH548Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with HRP.

Nexilin (NEXN) Polyclonal Antibody (Rat), PE
4-PAH548Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with PE.

Nexilin (NEXN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH548Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with APC-Cy7.

Nexilin (NEXN) Polyclonal Antibody (Rat), APC-Cy7
4-PAH548Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with APC-Cy7.

Nexn/ Rat Nexn ELISA Kit
ELI-38298r 96 Tests
EUR 886

Human NEXN-AS1 ELISA KIT
ELI-36728h 96 Tests
EUR 824

NEXN ELISA Kit (Human) (OKCD01960)
OKCD01960 96 Wells
EUR 831
Description: Description of target: Involved in regulating cell migration through association with the actin cytoskeleton. Has an essential role in the maintenance of Z line and sarcomere integrity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.1 pg/mL

Nexilin antibody
70R-2949 50 ug
EUR 467
Description: Rabbit polyclonal Nexilin antibody

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

Nexilin Blocking Peptide
33R-2372 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEXN antibody, catalog no. 70R-2949

NEXN siRNA
20-abx903538
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEXN siRNA
20-abx925786
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEXN siRNA
20-abx925787
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human NEXN shRNA Plasmid
20-abx964057
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEXN Recombinant Protein (Human)
RP041629 100 ug Ask for price

NEXN cloning plasmid
CSB-CL605897HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1704
  • Sequence: ATGGAGAAACAAAGACAAGAGGAACAAAGGAAGAGAACGGAGGAGGAACGAAAACGCAGAATTGAGCAGGATATGTTAGAAAAGAGGAAAATACAGCGTGAATTAGCAAAAAGGGCTGAACAGATTGAGGACATAAACAATACGGGAACTGAATCAGCATCAGAGGAAGGAGATG
  • Show more
Description: A cloning plasmid for the NEXN gene.

NEXN Rabbit pAb
A13136-100ul 100 ul
EUR 308

NEXN Rabbit pAb
A13136-200ul 200 ul
EUR 459

NEXN Rabbit pAb
A13136-20ul 20 ul
EUR 183

NEXN Rabbit pAb
A13136-50ul 50 ul
EUR 223

NEXN Polyclonal Antibody
27912-100ul 100ul
EUR 252

NEXN Polyclonal Antibody
27912-50ul 50ul
EUR 187

Anti-NEXN antibody
STJ115102 100 µl
EUR 277
Description: This gene encodes a filamentous actin-binding protein that may function in cell adhesion and migration. Mutations in this gene have been associated with dilated cardiomyopathy, also known as CMD1CC. Alternatively spliced transcript variants have been described.

NEXN ORF Vector (Human) (pORF)
ORF013877 1.0 ug DNA
EUR 354

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

NEXN Polyclonal Conjugated Antibody
C27912 100ul
EUR 397

Mouse NEXN shRNA Plasmid
20-abx976746
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NEXN shRNA Plasmid
20-abx987943
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEXN Recombinant Protein (Rat)
RP213755 100 ug Ask for price

NEXN Recombinant Protein (Rat)
RP213758 100 ug Ask for price

NEXN Recombinant Protein (Mouse)
RP153788 100 ug Ask for price

PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266

NEXN sgRNA CRISPR Lentivector set (Human)
K1419901 3 x 1.0 ug
EUR 339

NEXN-AS1 ORF Vector (Human) (pORF)
ORF026058 1.0 ug DNA Ask for price

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Nexn ORF Vector (Rat) (pORF)
ORF071253 1.0 ug DNA
EUR 506

Nexn ORF Vector (Rat) (pORF)
ORF071254 1.0 ug DNA
EUR 506

Nexn ORF Vector (Mouse) (pORF)
ORF051264 1.0 ug DNA
EUR 506

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

NEXN sgRNA CRISPR Lentivector (Human) (Target 1)
K1419902 1.0 ug DNA
EUR 154

NEXN sgRNA CRISPR Lentivector (Human) (Target 2)
K1419903 1.0 ug DNA
EUR 154

NEXN sgRNA CRISPR Lentivector (Human) (Target 3)
K1419904 1.0 ug DNA
EUR 154

NEXN Protein Vector (Human) (pPB-C-His)
PV055505 500 ng
EUR 481

NEXN Protein Vector (Human) (pPB-N-His)
PV055506 500 ng
EUR 481

NEXN Protein Vector (Human) (pPM-C-HA)
PV055507 500 ng
EUR 481

NEXN Protein Vector (Human) (pPM-C-His)
PV055508 500 ng
EUR 481

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Nexn sgRNA CRISPR Lentivector set (Mouse)
K3853301 3 x 1.0 ug
EUR 339

Nexn sgRNA CRISPR Lentivector set (Rat)
K7299201 3 x 1.0 ug
EUR 339

vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

NEXN-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV771875 1.0 ug DNA Ask for price

NEXN-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV771879 1.0 ug DNA Ask for price

NEXN-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV771880 1.0 ug DNA Ask for price

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Nexn sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3853302 1.0 ug DNA
EUR 154

Nexn sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3853303 1.0 ug DNA
EUR 154

Nexn sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3853304 1.0 ug DNA
EUR 154

Nexn sgRNA CRISPR Lentivector (Rat) (Target 1)
K7299202 1.0 ug DNA
EUR 154

Nexn sgRNA CRISPR Lentivector (Rat) (Target 2)
K7299203 1.0 ug DNA
EUR 154

Nexn sgRNA CRISPR Lentivector (Rat) (Target 3)
K7299204 1.0 ug DNA
EUR 154

NEXN Protein Vector (Rat) (pPB-C-His)
PV285010 500 ng
EUR 603

NEXN Protein Vector (Rat) (pPB-N-His)
PV285011 500 ng
EUR 603

NEXN Protein Vector (Rat) (pPM-C-HA)
PV285012 500 ng
EUR 603

NEXN Protein Vector (Rat) (pPM-C-His)
PV285013 500 ng
EUR 603

NEXN Protein Vector (Rat) (pPB-C-His)
PV285014 500 ng
EUR 603

NEXN Protein Vector (Rat) (pPB-N-His)
PV285015 500 ng
EUR 603

NEXN Protein Vector (Rat) (pPM-C-HA)
PV285016 500 ng
EUR 603

NEXN Protein Vector (Rat) (pPM-C-His)
PV285017 500 ng
EUR 603

NEXN Protein Vector (Mouse) (pPB-C-His)
PV205054 500 ng
EUR 603

NEXN Protein Vector (Mouse) (pPB-N-His)
PV205055 500 ng
EUR 603

NEXN Protein Vector (Mouse) (pPM-C-HA)
PV205056 500 ng
EUR 603

NEXN Protein Vector (Mouse) (pPM-C-His)
PV205057 500 ng
EUR 603

Nexn 3'UTR GFP Stable Cell Line
TU164021 1.0 ml Ask for price

Nexn 3'UTR Luciferase Stable Cell Line
TU213916 1.0 ml Ask for price

NEXN 3'UTR Luciferase Stable Cell Line
TU015606 1.0 ml
EUR 1521

Nexn 3'UTR Luciferase Stable Cell Line
TU114021 1.0 ml Ask for price

NEXN 3'UTR GFP Stable Cell Line
TU065606 1.0 ml
EUR 1521

Nexn 3'UTR GFP Stable Cell Line
TU263916 1.0 ml Ask for price

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

NEXN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1419905 3 x 1.0 ug
EUR 376

NEXN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV692479 1.0 ug DNA
EUR 682

NEXN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV692483 1.0 ug DNA
EUR 682

NEXN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV692484 1.0 ug DNA
EUR 682

NEXN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV692545 1.0 ug DNA
EUR 682

NEXN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV692549 1.0 ug DNA
EUR 682

NEXN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV692550 1.0 ug DNA
EUR 682

NEXN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1419906 1.0 ug DNA
EUR 167

NEXN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1419907 1.0 ug DNA
EUR 167

NEXN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1419908 1.0 ug DNA
EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

NEXN-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV771876 1.0 ug DNA Ask for price

NEXN-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV771877 1.0 ug DNA Ask for price

NEXN-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV771878 1.0 ug DNA Ask for price

Nexn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3853305 3 x 1.0 ug
EUR 376

Nexn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7299205 3 x 1.0 ug
EUR 376

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Nexn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3853306 1.0 ug DNA
EUR 167

Nexn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3853307 1.0 ug DNA
EUR 167

Nexn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3853308 1.0 ug DNA
EUR 167

NEXN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV692480 1.0 ug DNA
EUR 682

NEXN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV692481 1.0 ug DNA
EUR 740

NEXN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV692482 1.0 ug DNA
EUR 740

NEXN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV692546 1.0 ug DNA
EUR 682

NEXN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV692547 1.0 ug DNA
EUR 740

NEXN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV692548 1.0 ug DNA
EUR 740

Nexn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7299206 1.0 ug DNA
EUR 167

Nexn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7299207 1.0 ug DNA
EUR 167

Nexn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7299208 1.0 ug DNA
EUR 167

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit
ELA-E0121h 96 Tests
EUR 824

Human KIT/SCFR ELISA kit
LF-EK50791 1×96T
EUR 648

KIT ELISA Kit (Human) (OKAN04574)
OKAN04574 96 Wells
EUR 792
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

KIT ELISA Kit (Human) (OKCD06003)
OKCD06003 96 Wells
EUR 648
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

Human Biopterin ELISA Kit
CELI-66011h 96 Tests
EUR 824

Human lipopolysaccharides ELISA Kit
CELI-66031h 96 Tests
EUR 824

Human Microlbumin ELISA Kit
abx517025-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Trypsin ELISA kit
E01T0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit
E01T0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit
E01T0139-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit
E01T0140-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit
E01T0140-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit
E01T0140-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thyroglobulin ELISA kit
E01T0141-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thyroglobulin ELISA kit
E01T0141-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thyroglobulin ELISA kit
E01T0141-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Talin ELISA kit
E01T0222-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Talin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Talin ELISA kit
E01T0222-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Talin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Talin ELISA kit
E01T0222-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Talin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombomodulin ELISA kit
E01T0229-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombomodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombomodulin ELISA kit
E01T0229-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombomodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombomodulin ELISA kit
E01T0229-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombomodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin ELISA kit
E01T0336-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Thioredoxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin ELISA kit
E01T0336-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Thioredoxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin ELISA kit
E01T0336-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Thioredoxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transthyretin ELISA kit
E01T0362-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transthyretin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transthyretin ELISA kit
E01T0362-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transthyretin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transthyretin ELISA kit
E01T0362-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transthyretin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kisspeptin ELISA kit
E01T0490-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kisspeptin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kisspeptin ELISA kit
E01T0490-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kisspeptin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kisspeptin ELISA kit
E01T0490-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kisspeptin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tenascin ELISA kit
E01T0523-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tenascin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tenascin ELISA kit
E01T0523-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tenascin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tenascin ELISA kit
E01T0523-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tenascin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptase ELISA kit
E01T0532-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Tryptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptase ELISA kit
E01T0532-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Tryptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptase ELISA kit
E01T0532-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Tryptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tafazzin ELISA kit
E01T0752-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Tafazzin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tafazzin ELISA kit
E01T0752-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Tafazzin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tafazzin ELISA kit
E01T0752-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Tafazzin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA kit
E01T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA kit
E01T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA kit
E01T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ubiquitin ELISA kit
E01U0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ubiquitin ELISA kit
E01U0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ubiquitin ELISA kit
E01U0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Urokinase ELISA kit
E01U0010-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Urokinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Urokinase ELISA kit
E01U0010-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Urokinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Urokinase ELISA kit
E01U0010-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Urokinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Proteinuria ELISA kit
E01U0011-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Proteinuria in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Proteinuria ELISA kit
E01U0011-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Proteinuria in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Proteinuria ELISA kit
E01U0011-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Proteinuria in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Utrophin ELISA kit
E01U0030-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Utrophin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human NEXN(Nexilin) ELISA Kit