Human NEXN(Nexilin) ELISA Kit

Human NEXN(Nexilin) ELISA Kit

To Order: Contact us

Human Nexilin (NEXN) ELISA Kit

RDR-NEXN-Hu-96Tests 96 Tests
EUR 756

Human Nexilin (NEXN) ELISA Kit

RD-NEXN-Hu-48Tests 48 Tests
EUR 521

Human Nexilin (NEXN) ELISA Kit

RD-NEXN-Hu-96Tests 96 Tests
EUR 723

Human Nexilin (NEXN) ELISA Kit

20-abx152514
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Nexilin, NEXN ELISA KIT

ELI-23617h 96 Tests
EUR 824

Human Nexilin(NEXN)ELISA Kit

QY-E04760 96T
EUR 361

Human Nexilin (NEXN) ELISA Kit

SEH548Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

Human Nexilin (NEXN) ELISA Kit

SEH548Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

Human Nexilin (NEXN) ELISA Kit

SEH548Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

Human Nexilin (NEXN) ELISA Kit

SEH548Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

Human Nexilin (NEXN) ELISA Kit

4-SEH548Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Nexilin elisa. Alternative names of the recognized antigen: NELIN
  • F Actin Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Nexilin (NEXN) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Nexilin, Nexn ELISA KIT

ELI-44726m 96 Tests
EUR 865

for Nexilin (NEXN)ELISA kit

SEH548Mu-10x96wellstestplate 10x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit

SEH548Mu-1x48wellstestplate 1x48-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit

SEH548Mu-1x96wellstestplate 1x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit

SEH548Mu-5x96wellstestplate 5x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

ELISA Kit for Nexilin (NEXN)

4-SEH548Mu
  • Ask for price
  • Ask for price
  • Ask for price
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Nexilin elisa. Alternative names of the recognized antigen: NELIN
  • F Actin Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Nexilin (NEXN) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

for Nexilin (NEXN)ELISA kit

SEH548Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit

SEH548Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit

SEH548Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

for Nexilin (NEXN)ELISA kit

SEH548Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Nexilin (NEXN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Nexilin (NEXN) in serum, plasma, tissue homogenates and other biological fluids.

ELISA Kit for Nexilin (NEXN)

4-SEH548Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Nexilin elisa. Alternative names of the recognized antigen: NELIN
  • F Actin Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Nexilin (NEXN) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Nexilin (NEXN) Antibody

20-abx177803
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Nexilin (NEXN) Antibody

20-abx100201
  • EUR 328.00
  • EUR 133.00
  • EUR 871.00
  • EUR 453.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nexilin (NEXN) Antibody

20-abx129329
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nexilin (NEXN) Antibody

20-abx173818
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Nexilin (NEXN)

4-RPH548Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q7TPW1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Nexilin expressed in: E.coli

Recombinant Nexilin (NEXN)

4-RPH548Ra01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Z2J4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Nexilin expressed in: E.coli

ELISA kit for Human NEXN (Nexilin)

ELK3367 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nexilin (NEXN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nexilin (NEXN). Nex
  • Show more
Description: A sandwich ELISA kit for detection of Nexilin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Nexilin (NEXN)

KTE62219-48T 48T
EUR 332
  • The name nexilin came from the Latin word nexilis, meaning 'bound together.' Full-length b-nexilin contains an N-terminal F-actin-binding domain (ABD), followed by a spacer, a coiled-coil region, a second ABD, and a long C-terminal tail. In compariso
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Nexilin (NEXN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nexilin (NEXN)

KTE62219-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The name nexilin came from the Latin word nexilis, meaning 'bound together.' Full-length b-nexilin contains an N-terminal F-actin-binding domain (ABD), followed by a spacer, a coiled-coil region, a second ABD, and a long C-terminal tail. In compariso
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Nexilin (NEXN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nexilin (NEXN)

KTE62219-96T 96T
EUR 539
  • The name nexilin came from the Latin word nexilis, meaning 'bound together.' Full-length b-nexilin contains an N-terminal F-actin-binding domain (ABD), followed by a spacer, a coiled-coil region, a second ABD, and a long C-terminal tail. In compariso
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Nexilin (NEXN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Nexilin (NEXN) CLIA Kit

20-abx495472
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Nexilin (NEXN) Protein

20-abx654557
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Nexilin (NEXN) Protein

20-abx167347
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Nexilin (NEXN) Protein

20-abx068288
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nexilin (NEXN) Polyclonal Antibody (Mouse)

4-PAH548Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN)

Nexilin (NEXN) Polyclonal Antibody (Rat)

4-PAH548Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN)

Nexilin (NEXN) Polyclonal Antibody (Mouse), APC

4-PAH548Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with APC.

Nexilin (NEXN) Polyclonal Antibody (Mouse), Biotinylated

4-PAH548Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with Biotin.

Nexilin (NEXN) Polyclonal Antibody (Mouse), Cy3

4-PAH548Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with Cy3.

Nexilin (NEXN) Polyclonal Antibody (Mouse), FITC

4-PAH548Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with FITC.

Nexilin (NEXN) Polyclonal Antibody (Mouse), HRP

4-PAH548Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with HRP.

Nexilin (NEXN) Polyclonal Antibody (Mouse), PE

4-PAH548Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with PE.

Nexilin (NEXN) Polyclonal Antibody (Rat), APC

4-PAH548Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with APC.

Nexilin (NEXN) Polyclonal Antibody (Rat), Biotinylated

4-PAH548Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with Biotin.

Nexilin (NEXN) Polyclonal Antibody (Rat), Cy3

4-PAH548Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with Cy3.

Nexilin (NEXN) Polyclonal Antibody (Rat), FITC

4-PAH548Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with FITC.

Nexilin (NEXN) Polyclonal Antibody (Rat), HRP

4-PAH548Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with HRP.

Nexilin (NEXN) Polyclonal Antibody (Rat), PE

4-PAH548Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with PE.

Nexilin (NEXN) Polyclonal Antibody (Mouse), APC-Cy7

4-PAH548Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (His421~Tyr607)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nexilin (NEXN). This antibody is labeled with APC-Cy7.

Nexilin (NEXN) Polyclonal Antibody (Rat), APC-Cy7

4-PAH548Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEXN (Ala214~Gln455)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nexilin (NEXN). This antibody is labeled with APC-Cy7.

Nexn/ Rat Nexn ELISA Kit

ELI-38298r 96 Tests
EUR 886

Human NEXN-AS1 ELISA KIT

ELI-36728h 96 Tests
EUR 824

NEXN ELISA Kit (Human) (OKCD01960)

OKCD01960 96 Wells
EUR 831
Description: Description of target: Involved in regulating cell migration through association with the actin cytoskeleton. Has an essential role in the maintenance of Z line and sarcomere integrity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.1 pg/mL

Nexilin antibody

70R-2949 50 ug
EUR 467
Description: Rabbit polyclonal Nexilin antibody

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Nexilin Blocking Peptide

33R-2372 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEXN antibody, catalog no. 70R-2949

NEXN siRNA

20-abx903538
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEXN siRNA

20-abx925786
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEXN siRNA

20-abx925787
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human NEXN shRNA Plasmid

20-abx964057
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEXN Recombinant Protein (Human)

RP041629 100 ug Ask for price

NEXN Polyclonal Antibody

27912-100ul 100ul
EUR 252

NEXN Polyclonal Antibody

27912-50ul 50ul
EUR 187

NEXN Rabbit pAb

A13136-100ul 100 ul
EUR 308

NEXN Rabbit pAb

A13136-200ul 200 ul
EUR 459

NEXN Rabbit pAb

A13136-20ul 20 ul
EUR 183

NEXN Rabbit pAb

A13136-50ul 50 ul
EUR 223

NEXN cloning plasmid

CSB-CL605897HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1704
  • Sequence: ATGGAGAAACAAAGACAAGAGGAACAAAGGAAGAGAACGGAGGAGGAACGAAAACGCAGAATTGAGCAGGATATGTTAGAAAAGAGGAAAATACAGCGTGAATTAGCAAAAAGGGCTGAACAGATTGAGGACATAAACAATACGGGAACTGAATCAGCATCAGAGGAAGGAGATG
  • Show more
Description: A cloning plasmid for the NEXN gene.

Anti-NEXN antibody

STJ115102 100 µl
EUR 277
Description: This gene encodes a filamentous actin-binding protein that may function in cell adhesion and migration. Mutations in this gene have been associated with dilated cardiomyopathy, also known as CMD1CC. Alternatively spliced transcript variants have been described.

NEXN ORF Vector (Human) (pORF)

ORF013877 1.0 ug DNA
EUR 354

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Rat NEXN shRNA Plasmid

20-abx987943
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NEXN shRNA Plasmid

20-abx976746
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEXN Polyclonal Conjugated Antibody

C27912 100ul
EUR 397

NEXN Recombinant Protein (Mouse)

RP153788 100 ug Ask for price

NEXN Recombinant Protein (Rat)

RP213755 100 ug Ask for price

NEXN Recombinant Protein (Rat)

RP213758 100 ug Ask for price

NEXN sgRNA CRISPR Lentivector set (Human)

K1419901 3 x 1.0 ug
EUR 339

NEXN-AS1 ORF Vector (Human) (pORF)

ORF026058 1.0 ug DNA Ask for price

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Nexn ORF Vector (Rat) (pORF)

ORF071253 1.0 ug DNA
EUR 506

Human NEXN(Nexilin) ELISA Kit