Human NRGN(Neurogranin) ELISA Kit

Human NRGN(Neurogranin) ELISA Kit

To Order: Contact us

Human Neurogranin (NRGN) ELISA Kit
DLR-NRGN-Hu-96T 96T
EUR 621
  • Should the Human Neurogranin (NRGN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neurogranin (NRGN) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Neurogranin (NRGN) ELISA Kit
RDR-NRGN-Hu-48Tests 48 Tests
EUR 500
Human Neurogranin (NRGN) ELISA Kit
RDR-NRGN-Hu-96Tests 96 Tests
EUR 692
Human Neurogranin (NRGN) ELISA Kit
RD-NRGN-Hu-48Tests 48 Tests
EUR 478
Human Neurogranin (NRGN) ELISA Kit
RD-NRGN-Hu-96Tests 96 Tests
EUR 662
Neurogranin (NRGN) ELISA Kit
20-abx258434
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Neurogranin (NRGN) ELISA Kit
20-abx585166
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Neurogranin(NRGN) ELISA kit
CSB-EL016081HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neurogranin (NRGN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Neurogranin(NRGN) ELISA kit
1-CSB-EL016081HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neurogranin(NRGN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Neurogranin (NRGN) ELISA Kit
20-abx152496
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Neurogranin (NRGN) ELISA Kit
abx251757-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Human NRGN(Neurogranin) ELISA Kit
EH2396 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q92686
  • Alias: NRGN/RC3/hng
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml
Human NRGN/ Neurogranin ELISA Kit
E1793Hu 1 Kit
EUR 605
Human Neurogranin, NRGN ELISA KIT
ELI-23185h 96 Tests
EUR 824
Human Neurogranin (NRGN) ELISA Kit
CEA404Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Neurogranin (NRGN) ELISA Kit
CEA404Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Neurogranin (NRGN) ELISA Kit
CEA404Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Neurogranin (NRGN) ELISA Kit
CEA404Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Neurogranin (NRGN) ELISA Kit
4-CEA404Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurogranin elisa. Alternative names of the recognized antigen: Ng
  • NEUG
  • Protein Kinase C Substrate RC3
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Neurogranin (NRGN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Neurogranin (NRGN) ELISA Kit
abx574312-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Human Neurogranin ELISA Kit (NRGN)
RK01963 96 Tests
EUR 521
Mouse Neurogranin(NRGN) ELISA kit
CSB-EL016081MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Neurogranin (NRGN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Neurogranin(NRGN) ELISA kit
1-CSB-EL016081MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Neurogranin(NRGN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat Nrgn/ Neurogranin ELISA Kit
E0697Ra 1 Kit
EUR 646
Mouse Nrgn/ Neurogranin ELISA Kit
E1057Mo 1 Kit
EUR 632
Cow Neurogranin (NRGN) ELISA Kit
abx520791-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Neurogranin (NRGN) ELISA Kit
abx520793-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Rat Neurogranin (NRGN) ELISA Kit
abx520794-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Mouse Neurogranin, Nrgn ELISA KIT
ELI-36490m 96 Tests
EUR 865
Bovine Neurogranin, NRGN ELISA KIT
ELI-39513b 96 Tests
EUR 928
Rat Neurogranin ELISA Kit (NRGN)
RK03848 96 Tests
EUR 521
Neurogranin (NRGN) CLIA Kit
20-abx491457
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Neurogranin (NRGN) Antibody
20-abx006154
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Neurogranin (NRGN) Antibody
20-abx177756
  • EUR 1107.00
  • EUR 537.00
  • 1 mg
  • 200 ug
  • Please enquire.
Neurogranin (NRGN) Antibody
20-abx173771
  • EUR 314.00
  • EUR 787.00
  • EUR 411.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.
Neurogranin (NRGN) Antibody
20-abx242298
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Neurogranin (NRGN) Antibody
abx235676-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
ELISA kit for Human NRGN (Neurogranin)
ELK3321 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Neurogranin (NRGN) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neurogranin (NRGN) and unlabeled Neurogranin (NRGN) (Standards or samples) with the pre-c
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Neurogranin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human NRGN (Neurogranin)
ELK7646 1 plate of 96 wells
EUR 372
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurogranin (NRGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neurogranin (NR
  • Show more
Description: A sandwich ELISA kit for detection of Neurogranin from Human,Mouse,Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Neurogranin (NRGN) CLIA Kit
20-abx490088
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Neurogranin (NRGN) Protein
20-abx654515
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Human Neurogranin (NRGN) Protein
20-abx262390
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
Multi-species Neurogranin (NRGN) ELISA Kit
CEA404Mi-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Multi-species Neurogranin (NRGN) ELISA Kit
CEA404Mi-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Multi-species Neurogranin (NRGN) ELISA Kit
CEA404Mi-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Multi-species Neurogranin (NRGN) ELISA Kit
CEA404Mi-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Multi-species Neurogranin (NRGN) ELISA Kit
4-CEA404Mi
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurogranin elisa. Alternative names of the recognized antigen: Ng
  • NEUG
  • Protein Kinase C Substrate RC3
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Multi-species Neurogranin (NRGN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
ELISA kit for Rat Neurogranin (NRGN)
KTE101185-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Rat Neurogranin (NRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Neurogranin (NRGN)
KTE101185-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Rat Neurogranin (NRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Neurogranin (NRGN)
KTE101185-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Rat Neurogranin (NRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Multi-species Neurogranin (NRGN) ELISA Kit
SEA404Mi-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in tissue homogenates, cell lysates and other biological fluids.
Multi-species Neurogranin (NRGN) ELISA Kit
SEA404Mi-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in tissue homogenates, cell lysates and other biological fluids.
Multi-species Neurogranin (NRGN) ELISA Kit
SEA404Mi-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in tissue homogenates, cell lysates and other biological fluids.
Multi-species Neurogranin (NRGN) ELISA Kit
SEA404Mi-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in tissue homogenates, cell lysates and other biological fluids.
Multi-species Neurogranin (NRGN) ELISA Kit
4-SEA404Mi
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurogranin elisa. Alternative names of the recognized antigen: Ng
  • NEUG
  • Protein Kinase C Substrate RC3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Multi-species Neurogranin (NRGN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Nrgn ELISA Kit| Rat Neurogranin ELISA Kit
EF019049 96 Tests
EUR 689
Nrgn ELISA Kit| Mouse Neurogranin ELISA Kit
EF015658 96 Tests
EUR 689
NRGN ELISA Kit| Bovine Neurogranin ELISA Kit
EF011658 96 Tests
EUR 689
Neurogranin (NRGN) Monoclonal Antibody (Human)
4-MAA404Hu22
  • EUR 241.00
  • EUR 2417.00
  • EUR 604.00
  • EUR 301.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN)
NRGN Neurogranin Human Recombinant Protein
PROTQ92686 Regular: 10ug
EUR 317
Description: NRGN Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 101 amino acids (1-78 a.a.) and having a molecular mass of 10.0kDa (molecular size on SDS-PAGE will appear higher). ;NRGN is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
ELISA kit for Mouse Neurogranin (NRGN)  Kit
KTE71596-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Mouse Neurogranin (NRGN)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Neurogranin (NRGN)  Kit
KTE71596-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Mouse Neurogranin (NRGN)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Neurogranin (NRGN)  Kit
KTE71596-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Mouse Neurogranin (NRGN)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Polyclonal NRGN / Neurogranin Antibody (Internal)
AMM06825G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NRGN / Neurogranin (Internal). This antibody is tested and proven to work in the following applications:
Neurogranin (NRGN) Monoclonal Antibody (Human), APC
4-MAA404Hu22-APC
  • EUR 336.00
  • EUR 3149.00
  • EUR 881.00
  • EUR 427.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with APC.
Neurogranin (NRGN) Monoclonal Antibody (Human), Biotinylated
4-MAA404Hu22-Biotin
  • EUR 305.00
  • EUR 2367.00
  • EUR 704.00
  • EUR 371.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with Biotin.
Neurogranin (NRGN) Monoclonal Antibody (Human), Cy3
4-MAA404Hu22-Cy3
  • EUR 407.00
  • EUR 4157.00
  • EUR 1133.00
  • EUR 528.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with Cy3.
Neurogranin (NRGN) Monoclonal Antibody (Human), FITC
4-MAA404Hu22-FITC
  • EUR 289.00
  • EUR 2539.00
  • EUR 724.00
  • EUR 361.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with FITC.
Neurogranin (NRGN) Monoclonal Antibody (Human), HRP
4-MAA404Hu22-HRP
  • EUR 308.00
  • EUR 2745.00
  • EUR 780.00
  • EUR 387.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with HRP.
Neurogranin (NRGN) Monoclonal Antibody (Human), PE
4-MAA404Hu22-PE
  • EUR 289.00
  • EUR 2539.00
  • EUR 724.00
  • EUR 361.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with PE.
Neurogranin (NRGN) Monoclonal Antibody (Human), APC-Cy7
4-MAA404Hu22-APC-Cy7
  • EUR 553.00
  • EUR 6178.00
  • EUR 1642.00
  • EUR 734.00
  • EUR 311.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with APC-Cy7.
Nrgn/ Rat Nrgn ELISA Kit
ELI-23186r 96 Tests
EUR 886
Human NRGN ELISA Kit
ELA-E8816h 96 Tests
EUR 824
NRGN ELISA KIT|Human
EF006445 96 Tests
EUR 689
ELISA kit for Human Neurogranin
EK4821 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Neurogranin in samples from serum, plasma, tissue homogenates and other biological fluids.
NRGN ELISA Kit (Human) (OKEH01858)
OKEH01858 96 Wells
EUR 779
Description: Description of target: Neurogranin (NRGN) is the human homolog of the neuron-specific rat RC3/neurogranin gene. This gene encodes a postsynaptic protein kinase substrate that binds calmodulin in the absence of calcium. The NRGN gene contains four exons and three introns. The exons 1 and 2 encode the protein and exons 3 and 4 contain untranslated sequences. It is suggested that the NRGN is a direct target for thyroid hormone in human brain, and that control of expression of this gene could underlay many of the consequences of hypothyroidism on mental states during development as well as in adult subjects.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL
Neurogranin
PR27174 10 ug
EUR 318
Human Neurogranin (NRG
QY-E05326 96T
EUR 361
NRGN ELISA Kit (Mouse) (OKEH05025)
OKEH05025 96 Wells
EUR 779
Description: Description of target: Regulates the affinity of calmodulin for calcium. Involved in synaptic plasticity and spatial learning.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.5 pg/mL
NRGN ELISA Kit (Rat) (OKEH05970)
OKEH05970 96 Wells
EUR 870
Description: Description of target: Regulates the affinity of calmodulin for calcium. Involved in synaptic plasticity and spatial learning.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.6 pg/mL
Neurogranin precursor
GT41024 100 ug
EUR 487
Neurogranin precursor
P41019 100 ug Blocking Peptide
EUR 239
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
NRGN antibody
70R-18965 50 ul
EUR 435
Description: Rabbit polyclonal NRGN antibody
NRGN Antibody
35545-100ul 100ul
EUR 252
NRGN Antibody
1-CSB-PA793948
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NRGN. Recognizes NRGN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
NRGN Antibody
1-CSB-PA016081GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NRGN. Recognizes NRGN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
NRGN siRNA
20-abx903658
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NRGN siRNA
20-abx926396
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NRGN siRNA
20-abx926397
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pENTR223-NRGN
PVT12314 2 ug
EUR 391
Human NRGN shRNA Plasmid
20-abx953256
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Neurogranin (28-43)
5-01591 4 x 1mg Ask for price
Neurogranin precursor Antibody
abx432061-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
anti- Neurogranin antibody
FNab05676 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • IP: 1:500-1:2000
  • Immunogen: neurogranin(protein kinase C substrate, RC3)
  • Uniprot ID: Q92686
  • Research Area: Neuroscience, Signal Transduction, Developmental biology
Description: Antibody raised against Neurogranin
Anti-Neurogranin antibody
PAab05676 100 ug
EUR 355
NRGN Conjugated Antibody
C35545 100ul
EUR 397
NRGN cloning plasmid
CSB-CL849776HU-10ug 10ug
EUR 185
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 237
  • Sequence: atggactgctgcaccgagaacgcctgctccaagccggacgacgacattctagacatcccgctggacgatcccggcgccaacgcggccgccgccaaaatccaggcgagttttcggggccacatggcgcggaagaagataaagagcggagagcgcggccggaagggcccgggccctgg
  • Show more
Description: A cloning plasmid for the NRGN gene.
NRGN Rabbit pAb
A8444-100ul 100 ul
EUR 308
NRGN Rabbit pAb
A8444-200ul 200 ul
EUR 459
NRGN Rabbit pAb
A8444-20ul 20 ul
EUR 183
NRGN Rabbit pAb
A8444-50ul 50 ul
EUR 223
Anti-NRGN antibody
STJ110742 100 µl
EUR 277
Description: Neurogranin (NRGN) is the human homolog of the neuron-specific rat RC3/neurogranin gene. This gene encodes a postsynaptic protein kinase substrate that binds calmodulin in the absence of calcium. The NRGN gene contains four exons and three introns. The exons 1 and 2 encode the protein and exons 3 and 4 contain untranslated sequences. It is suggested that the NRGN is a direct target for thyroid hormone in human brain, and that control of expression of this gene could underlay many of the consequences of hypothyroidism on mental states during development as well as in adult subjects.
NRGN ORF Vector (Human) (pORF)
ORF007219 1.0 ug DNA
EUR 95
Anti-Neurogranin precursor Antibody
A05781 100ug/200ul
EUR 397
Description: Goat Polyclonal Neurogranin precursor Antibody. Validated in IHC and tested in Human, Mouse.
Neurogranin precursor Antibody (Biotin)
abx433025-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Anti-Neurogranin precursor antibody
STJ72056 100 µg
EUR 359
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
NRGN protein (His tag)
80R-3867 50 ug
EUR 327
Description: Purified recombinant NRGN protein (His tag)
Mouse NRGN shRNA Plasmid
20-abx975246
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat NRGN shRNA Plasmid
20-abx986218
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
NRGN sgRNA CRISPR Lentivector set (Human)
K1455201 3 x 1.0 ug
EUR 339
Biotin-LC-Neurogranin (28-43)
5-00801 4 x 1mg Ask for price
Anti-Neurogranin precursor, Biotinylated antibody
STJ73494 100 µg
EUR 359
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9
Polyclonal NRGN Antibody (C-term)
AMM06826G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NRGN (C-term). This antibody is tested and proven to work in the following applications:
Nrgn ORF Vector (Rat) (pORF)
ORF071515 1.0 ug DNA
EUR 506
Nrgn ORF Vector (Mouse) (pORF)
ORF051676 1.0 ug DNA
EUR 506
NRGN sgRNA CRISPR Lentivector (Human) (Target 1)
K1455202 1.0 ug DNA
EUR 154
NRGN sgRNA CRISPR Lentivector (Human) (Target 2)
K1455203 1.0 ug DNA
EUR 154
NRGN sgRNA CRISPR Lentivector (Human) (Target 3)
K1455204 1.0 ug DNA
EUR 154
NRGN Protein Vector (Human) (pPB-C-His)
PV028873 500 ng
EUR 329
NRGN Protein Vector (Human) (pPB-N-His)
PV028874 500 ng
EUR 329
NRGN Protein Vector (Human) (pPM-C-HA)
PV028875 500 ng
EUR 329
NRGN Protein Vector (Human) (pPM-C-His)
PV028876 500 ng
EUR 329
Recombinant Human NRGN Protein, His, E.coli-10ug
QP12881-10ug 10ug
EUR 201
Recombinant Human NRGN Protein, His, E.coli-1mg
QP12881-1mg 1mg
EUR 5251
Recombinant Human NRGN Protein, His, E.coli-2ug
QP12881-2ug 2ug
EUR 155
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Polyclonal Goat Anti-Neurogranin precursor Antibody
APR12132G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Neurogranin precursor . This antibody is tested and proven to work in the following applications:
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
Nrgn sgRNA CRISPR Lentivector set (Rat)
K7101101 3 x 1.0 ug
EUR 339
Nrgn sgRNA CRISPR Lentivector set (Mouse)
K4479301 3 x 1.0 ug
EUR 339
Neurogranin (Protein Kinase C Substrate, Rc3) Antibody
20-abx114073
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428
vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
Nrgn sgRNA CRISPR Lentivector (Rat) (Target 1)
K7101102 1.0 ug DNA
EUR 154
Nrgn sgRNA CRISPR Lentivector (Rat) (Target 2)
K7101103 1.0 ug DNA
EUR 154
Nrgn sgRNA CRISPR Lentivector (Rat) (Target 3)
K7101104 1.0 ug DNA
EUR 154
Nrgn sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4479302 1.0 ug DNA
EUR 154
Nrgn sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4479303 1.0 ug DNA
EUR 154
Nrgn sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4479304 1.0 ug DNA
EUR 154
NRGN Protein Vector (Rat) (pPB-C-His)
PV286058 500 ng
EUR 603
NRGN Protein Vector (Rat) (pPB-N-His)
PV286059 500 ng
EUR 603
NRGN Protein Vector (Rat) (pPM-C-HA)
PV286060 500 ng
EUR 603
NRGN Protein Vector (Rat) (pPM-C-His)
PV286061 500 ng
EUR 603
NRGN Protein Vector (Mouse) (pPB-C-His)
PV206702 500 ng
EUR 603
NRGN Protein Vector (Mouse) (pPB-N-His)
PV206703 500 ng
EUR 603
NRGN Protein Vector (Mouse) (pPM-C-HA)
PV206704 500 ng
EUR 603
NRGN Protein Vector (Mouse) (pPM-C-His)
PV206705 500 ng
EUR 603
Nrgn 3'UTR Luciferase Stable Cell Line
TU114323 1.0 ml Ask for price
Nrgn 3'UTR GFP Stable Cell Line
TU164323 1.0 ml Ask for price
Nrgn 3'UTR Luciferase Stable Cell Line
TU214192 1.0 ml Ask for price
Nrgn 3'UTR GFP Stable Cell Line
TU264192 1.0 ml Ask for price
NRGN 3'UTR GFP Stable Cell Line
TU065972 1.0 ml
EUR 1394
NRGN 3'UTR Luciferase Stable Cell Line
TU015972 1.0 ml
EUR 1394
NRGN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1455205 3 x 1.0 ug
EUR 376
NRGN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV657805 1.0 ug DNA
EUR 514
NRGN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV657809 1.0 ug DNA
EUR 514
NRGN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV657810 1.0 ug DNA
EUR 514
NRGN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1455206 1.0 ug DNA
EUR 167
NRGN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1455207 1.0 ug DNA
EUR 167
NRGN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1455208 1.0 ug DNA
EUR 167

Human NRGN(Neurogranin) ELISA Kit