Human PAEP(Progestagen Associated Endometrial Protein) ELISA Kit

Human PAEP(Progestagen Associated Endometrial Protein) ELISA Kit

To Order: Contact us

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
DLR-PAEP-Hu-96T 96T
EUR 673
  • Should the Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Progestagen Associated Endometrial Protein (PAEP) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
RD-PAEP-Hu-48Tests 48 Tests
EUR 521
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
RD-PAEP-Hu-96Tests 96 Tests
EUR 723
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
RDR-PAEP-Hu-48Tests 48 Tests
EUR 544
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
RDR-PAEP-Hu-96Tests 96 Tests
EUR 756
Progestagen-Associated Endometrial Protein (PAEP) Protein
20-abx262595
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody
20-abx126995
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody
20-abx004400
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody
abx028157-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody
abx028157-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Progestagen Associated Endometrial Protein (PAEP) Antibody
20-abx174167
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Progestagen Associated Endometrial Protein (PAEP) Antibody
20-abx178096
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Progestagen-Associated Endometrial Protein (PAEP) Antibody
20-abx301834
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody
20-abx211693
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody
20-abx213124
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
20-abx152622
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
SEC709Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids.
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
SEC709Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids.
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
SEC709Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids.
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
SEC709Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids.
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
4-SEC709Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Progestagen Associated Endometrial Protein elisa. Alternative names of the recognized antigen: GD
  • GdA
  • GdF
  • GdS
  • PAEG
  • PEP
  • PP14
  • Glycodelin
  • Placental Protein 14
  • Alpha Uterine Protein
  • Pregnancy-Associated Endometrial Alpha-2-Globuli
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Progestagen Associated Endometrial Protein (PAEP) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Progestagen Associated Endometrial Protein ELISA Kit (PAEP)
RK02007 96 Tests
EUR 521
Human Progestagen Associated Endometrial Protein(PAEP)ELISA Kit
QY-E01907 96T
EUR 361
Human Progestagen Associated Endometrial Protein (PAEP) Protein
20-abx654801
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Monkey Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit
abx359635-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit
abx361451-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit
abx362423-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Sheep Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit
abx364352-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.
Chicken Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit
abx356335-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Progestagen Associated Endometrial Protein (PAEP) CLIA Kit
20-abx493852
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Progestagen-Associated Endometrial Protein (PAEP) CLIA Kit
abx197540-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody (HRP)
20-abx315904
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody (FITC)
20-abx315905
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Progestagen-Associated Endometrial Protein (PAEP) Antibody (Biotin)
20-abx315906
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ELISA kit for Human PAEP (Progestagen Associated Endometrial Protein)
ELK3531 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Progestagen Associated Endometrial Protein (PAEP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antib
  • Show more
Description: A sandwich ELISA kit for detection of Progestagen Associated Endometrial Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Progestagen Associated Endometrial Protein (PAEP)
KTE61318-48T 48T
EUR 354
  • Glycodelin is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Progestagen Associated Endometrial Protein (PAEP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Progestagen Associated Endometrial Protein (PAEP)
KTE61318-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Glycodelin is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Progestagen Associated Endometrial Protein (PAEP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Progestagen Associated Endometrial Protein (PAEP)
KTE61318-96T 96T
EUR 572
  • Glycodelin is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Progestagen Associated Endometrial Protein (PAEP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
PAEP Progesterone-Associated Endometrial Protein Human Recombinant Protein
PROTP09466 Regular: 10ug
EUR 317
Description: PAEP Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 185 amino acids (19-180a.a) and having a molecular mass of 21kDa. ;PAEP is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Human PAEP ELISA Kit
ELA-E10200h 96 Tests
EUR 824
PAEP ELISA KIT|Human
EF002066 96 Tests
EUR 689
Human PAEP/ Glycodelin ELISA Kit
E1860Hu 1 Kit
EUR 605
Human PAEP(Glycodelin) ELISA Kit
EH1142 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P09466
  • Alias: PAEP(Progestagen-Associated Endometrial Protein)/Glycodelin/PP14/alpha uterine protein/GdF/GdS/glycodelin-A/glycodelin-F/glycodelin-S/PEP/Placental protein 14/Pregnancy-associated endometrial
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Glycodelin, PAEP ELISA KIT
ELI-03273h 96 Tests
EUR 824
Human Glycodelin (PAEP) ELISA Kit
abx250392-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
PAEP ELISA Kit (Human) (OKAN05291)
OKAN05291 96 Wells
EUR 792
Description: Description of target: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.1 ng/mL
PAEP ELISA Kit (Human) (OKCD08232)
OKCD08232 96 Wells
EUR 975
Description: Description of target: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 2.1ng/mL
PAEP Recombinant Protein (Human)
RP022438 100 ug Ask for price
PAEP ELISA Kit (Bovine) (OKAN06339)
OKAN06339 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.067 ng/mL
Human Glycodelin (PAEP)
1-CSB-EP017381HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 22.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glycodelin(PAEP) expressed in E.coli
Human Glycodelin (PAEP)
1-CSB-MP017381HU
  • EUR 358.00
  • EUR 1257.00
  • EUR 514.00
  • EUR 927.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 23.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glycodelin(PAEP) expressed in Mammalian cell
PAEP ELISA Kit (Human) : 96 Wells (OKEH02065)
OKEH02065 96 Wells
EUR 662
Description: Description of target: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78 ng/mL
Human Endometrial Adenocarcinoma CAFs
CAF01 1,000,000 cells
EUR 1223
PAEP siRNA
20-abx927607
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PAEP Antibody
ABD2701 100 ug
EUR 438
PAEP Antibody
33016-100ul 100ul
EUR 252
PAEP Antibody
DF2701 200ul
EUR 304
Description: PAEP antibody detects endogenous levels of total PAEP.
PAEP Antibody
1-CSB-PA198597
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300
PAEP Antibody
1-CSB-PA043641
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:100-1:300
PAEP Antibody
1-CSB-PA017381LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
PAEP protein (His tag)
80R-2711 50 ug
EUR 424
Description: Purified recombinant PAEP protein (His tag)
Human PAEP shRNA Plasmid
20-abx953353
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PAEP Conjugated Antibody
C33016 100ul
EUR 397
PAEP cloning plasmid
CSB-CL017381HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 543
  • Sequence: atgctgtgcctcctgctcaccctgggcgtggccctggtctgtggtgtcccggccatggacatcccccagaccaagcaggacctggagctcccaaagttggcagggacctggcactccatggccatggcgaccaacaacatctccctcatggcgacactgaaggcccctctgagggt
  • Show more
Description: A cloning plasmid for the PAEP gene.
PAEP Polyclonal Antibody
ES10976-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PAEP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
PAEP Polyclonal Antibody
ES10976-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PAEP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
PAEP Polyclonal Antibody
ABP59813-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PAEP protein
  • Applications tips:
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein
PAEP Polyclonal Antibody
ABP59813-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PAEP protein
  • Applications tips:
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein
PAEP Polyclonal Antibody
ABP59813-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PAEP protein
  • Applications tips:
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein
PAEP Rabbit pAb
A11810-100ul 100 ul
EUR 308
PAEP Rabbit pAb
A11810-200ul 200 ul
EUR 459
PAEP Rabbit pAb
A11810-20ul 20 ul Ask for price
PAEP Rabbit pAb
A11810-50ul 50 ul Ask for price
PAEP Rabbit pAb
A5751-100ul 100 ul
EUR 308
PAEP Rabbit pAb
A5751-200ul 200 ul
EUR 459
PAEP Rabbit pAb
A5751-20ul 20 ul
EUR 183
PAEP Rabbit pAb
A5751-50ul 50 ul
EUR 223
PAEP Rabbit pAb
A14757-100ul 100 ul
EUR 308
PAEP Rabbit pAb
A14757-200ul 200 ul
EUR 459
PAEP Rabbit pAb
A14757-20ul 20 ul
EUR 183
PAEP Rabbit pAb
A14757-50ul 50 ul
EUR 223
PAEP Blocking Peptide
DF2701-BP 1mg
EUR 195
Anti-PAEP antibody
STJ28318 100 µl
EUR 277
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.
Anti-PAEP antibody
STJ113389 100 µl
EUR 277
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.
Anti-PAEP antibody
STJ116957 100 µl
EUR 277
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.
Anti-PAEP antibody
STJ192134 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PAEP
PAEP ORF Vector (Human) (pORF)
ORF007480 1.0 ug DNA
EUR 95
PAEP Protein Vector (Human) (pPB-C-His)
PV029917 500 ng
EUR 329
PAEP Protein Vector (Human) (pPB-N-His)
PV029918 500 ng
EUR 329
PAEP Protein Vector (Human) (pPM-C-HA)
PV029919 500 ng
EUR 329
PAEP Protein Vector (Human) (pPM-C-His)
PV029920 500 ng
EUR 329
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
Immortalized Human Endometrial Stromal Cells-SV40
T9201 1x106 cells / 1.0 ml
EUR 1500
Immortalized Human Endometrial Stromal Cells (HESC)
T0533 1x106 cells / 1.0 ml
EUR 1500
PAEP Antibody, HRP conjugated
1-CSB-PA017381LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PAEP Antibody, FITC conjugated
1-CSB-PA017381LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PAEP Antibody, Biotin conjugated
1-CSB-PA017381LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
EM (Anti-endometrial Antibody IgG) ELISA test
56 96T/Box Ask for price
  • Area of application: Immunological infertility
Description: ELISA based test for quantitative detection of EM (Anti-endometrial Antibody IgG)
EM (Anti-endometrial Antibody IgM) ELISA test
57 96T/Box Ask for price
  • Area of application: Immunological infertility
Description: ELISA based test for quantitative detection of EM (Anti-endometrial Antibody IgM)
EM (Anti-endometrial Antibody IgA) ELISA test
58 96T/Box Ask for price
  • Area of application: Immunological infertility
Description: ELISA based test for quantitative detection of EM (Anti-endometrial Antibody IgA)
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
PAEP sgRNA CRISPR Lentivector set (Human)
K1587501 3 x 1.0 ug
EUR 339
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Human Cervix PrimaCell4: Normal Endometrial Epithelial Cells
2-96047 1 Kit Ask for price
Human Cytotoxin- associated protein ELISA Kit
ELA-E1229h 96 Tests
EUR 824
PAEP sgRNA CRISPR Lentivector (Human) (Target 1)
K1587502 1.0 ug DNA
EUR 154
PAEP sgRNA CRISPR Lentivector (Human) (Target 2)
K1587503 1.0 ug DNA
EUR 154
PAEP sgRNA CRISPR Lentivector (Human) (Target 3)
K1587504 1.0 ug DNA
EUR 154
Endometrial Tumor Tissue Array - 12 cases of endometrial cancer paired with adjacent normal tissues
Z7020023 5 slides
EUR 1381
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Human Vesicle-associated membrane protein-associated protein A (VAPA) ELISA Kit
abx384213-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Human zeta-associated protein 70 ELISA kit
E01Z0037-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human zeta-associated protein 70 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human zeta-associated protein 70 ELISA kit
E01Z0037-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human zeta-associated protein 70 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human zeta-associated protein 70 ELISA kit
E01Z0037-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human zeta-associated protein 70 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Death Associated Protein 6 ELISA kit
E01D0137-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Death Associated Protein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Death Associated Protein 6 ELISA kit
E01D0137-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Death Associated Protein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Death Associated Protein 6 ELISA kit
E01D0137-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Death Associated Protein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human BCL2 Associated X Protein ELISA kit
E01B0032-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human BCL2 Associated X Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human BCL2 Associated X Protein ELISA kit
E01B0032-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human BCL2 Associated X Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human BCL2 Associated X Protein ELISA kit
E01B0032-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human BCL2 Associated X Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human BRCA1 associated protein(BRAP) ELISA kit
E01B0833-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human BRCA1 associated protein(BRAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human BRCA1 associated protein(BRAP) ELISA kit
E01B0833-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human BRCA1 associated protein(BRAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human BRCA1 associated protein(BRAP) ELISA kit
E01B0833-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human BRCA1 associated protein(BRAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Microtubule associated protein 1 ELISA kit
E01M0223-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Microtubule associated protein 1 ELISA kit
E01M0223-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Microtubule associated protein 1 ELISA kit
E01M0223-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Microtubule associated protein 2 ELISA kit
E01M0226-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Microtubule associated protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Microtubule associated protein 2 ELISA kit
E01M0226-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Microtubule associated protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Microtubule associated protein 2 ELISA kit
E01M0226-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Microtubule associated protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Microtubule associated protein 1B ELISA kit
E01M0231-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Microtubule associated protein 1B ELISA kit
E01M0231-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Microtubule associated protein 1B ELISA kit
E01M0231-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Contactin Associated Protein 1 ELISA kit
E01C0340-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Contactin Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Contactin Associated Protein 1 ELISA kit
E01C0340-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Contactin Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Contactin Associated Protein 1 ELISA kit
E01C0340-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Contactin Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytotoxin associated protein(CagA) ELISA kit
E01C1309-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytotoxin associated protein(CagA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytotoxin associated protein(CagA) ELISA kit
E01C1309-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytotoxin associated protein(CagA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytotoxin associated protein(CagA) ELISA kit
E01C1309-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytotoxin associated protein(CagA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Synaptosome Associated Protein 25 ELISA kit
E01S0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Synaptosome Associated Protein 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Synaptosome Associated Protein 25 ELISA kit
E01S0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Synaptosome Associated Protein 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Synaptosome Associated Protein 25 ELISA kit
E01S0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Synaptosome Associated Protein 25 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Spermatid associated protein(SPERT) ELISA kit
E01S0396-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Spermatid associated protein(SPERT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Spermatid associated protein(SPERT) ELISA kit
E01S0396-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Spermatid associated protein(SPERT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Spermatid associated protein(SPERT) ELISA kit
E01S0396-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Spermatid associated protein(SPERT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Growth Associated Protein 43 ELISA kit
E01G0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Growth Associated Protein 43 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Growth Associated Protein 43 ELISA kit
E01G0080-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Growth Associated Protein 43 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Growth Associated Protein 43 ELISA kit
E01G0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Growth Associated Protein 43 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human PDGFA Associated Protein 1 ELISA kit
E01P0070-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human PDGFA Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human PDGFA Associated Protein 1 ELISA kit
E01P0070-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human PDGFA Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human PDGFA Associated Protein 1 ELISA kit
E01P0070-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human PDGFA Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CD2 associated protein(CD2AP) ELISA kit
E01C1474-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human CD2 associated protein(CD2AP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CD2 associated protein(CD2AP) ELISA kit
E01C1474-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human CD2 associated protein(CD2AP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PAEP(Progestagen Associated Endometrial Protein) ELISA Kit