Human STC1(Stanniocalcin 1) ELISA Kit

Human STC1(Stanniocalcin 1) ELISA Kit

To Order: Contact us

Human Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Stanniocalcin 1 (STC1) ELISA Kit
abx576396-96tests	Abbexa	96 tests	EUR 739
Shipped within 1-3 weeks.

Human STC1/ Stanniocalcin-1 ELISA Kit
E2412Hu	Sunlong	1 Kit	EUR 605

Human Stanniocalcin- 1, STC1 ELISA KIT
ELI-41328h	Lifescience Market	96 Tests	EUR 824

Human Stanniocalcin 1 (STC1) ELISA Kit
20-abx153168	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Stanniocalcin-1(STC1) ELISA kit
CSB-EL022821HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Stanniocalcin-1(STC1) ELISA kit
1-CSB-EL022821HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
4-SEC874Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Stanniocalcin 1 ELISA Kit (STC1)
RK02343	Abclonal	96 Tests	EUR 521

Human Stanniocalcin-1 (STC1)
1-CSB-RP098854h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 50.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli

Human Stanniocalcin-1 (STC1)
1-CSB-RP098874HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 39.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli

Cow Stanniocalcin 1 (STC1) ELISA Kit
abx555794-96tests	Abbexa	96 tests	EUR 911
Shipped within 1-3 weeks.

Rat Stanniocalcin 1 (STC1) ELISA Kit
abx571149-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
abx576405-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Bovine Stanniocalcin- 1, STC1 ELISA KIT
ELI-13825b	Lifescience Market	96 Tests	EUR 928

Mouse Stanniocalcin- 1, Stc1 ELISA KIT
ELI-39536m	Lifescience Market	96 Tests	EUR 865

Rat Stanniocalcin 1 (STC1) ELISA Kit
20-abx156121	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
20-abx154711	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Stanniocalcin-1(STC1) ELISA kit
CSB-EL022821MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Stanniocalcin-1(STC1) ELISA kit
1-CSB-EL022821MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
4-SEC874Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
4-SEC874Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Stanniocalcin 1 (STC1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Stanniocalcin 1 ELISA Kit (STC1)
RK03214	Abclonal	96 Tests	EUR 521

Stanniocalcin 1 (STC1) Antibody
20-abx132353	Abbexa	EUR 328.00 EUR 829.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx101392	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx006838	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
abx028371-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
abx028371-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx174633	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Stanniocalcin 1 (STC1) Antibody
20-abx306443	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx320305	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
abx238315-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx241299	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx178466	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Stanniocalcin 1 (STC1) Antibody
20-abx178467	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Stanniocalcin 1 (STC1) Antibody
20-abx178468	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Recombinant Stanniocalcin 1 (STC1)
4-RPC874Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P52823 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 56.8kDa Isoelectric Point: 7.3
Description: Recombinant Human Stanniocalcin 1 expressed in: E.coli

Recombinant Stanniocalcin 1 (STC1)
4-RPC874Mu01	Cloud-Clone	EUR 510.37 EUR 239.00 EUR 1638.88 EUR 612.96 EUR 1125.92 EUR 404.00 EUR 3947.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 54.7kDa Isoelectric Point: 8.9
Description: Recombinant Mouse Stanniocalcin 1 expressed in: E.coli

Human Stanniocalcin 1/STC1 PicoKine ELISA Kit
EK1404	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human STC1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

ELISA kit for Human STC1 (Stanniocalcin 1)
ELK3332	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-48T	Abbkine	48T	EUR 332
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-96T	Abbkine	96T	EUR 539
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Stanniocalcin 1 (STC1) CLIA Kit
20-abx493944	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Stanniocalcin 1 (STC1) Protein
20-abx069167	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Mouse STC1 (Stanniocalcin 1)
ELK6277	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat STC1 (Stanniocalcin 1)
ELK6427	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-48T	Abbkine	48T	EUR 332
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-96T	Abbkine	96T	EUR 539
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-48T	Abbkine	48T	EUR 332
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-96T	Abbkine	96T	EUR 539
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Stc1 ELISA Kit| Rat Stanniocalcin-1 ELISA Kit
EF019372	Lifescience Market	96 Tests	EUR 689

Stc1 ELISA Kit| Mouse Stanniocalcin-1 ELISA Kit
EF016295	Lifescience Market	96 Tests	EUR 689

STC1 ELISA Kit| Bovine Stanniocalcin-1 ELISA Kit
EF011935	Lifescience Market	96 Tests	EUR 689

Mouse Stanniocalcin 1 (STC1) CLIA Kit
20-abx493945	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Stanniocalcin 1 (STC1) CLIA Kit
20-abx493946	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Stanniocalcin 1 (STC1) Protein
20-abx655127	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat Stanniocalcin 1 (STC1) Protein
20-abx655128	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Stanniocalcin 1 (STC1) Protein
20-abx655129	Abbexa	EUR 718.00 EUR 286.00 EUR 2207.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Stanniocalcin 1 Polyclonal (STC1) Antibody
20-abx116920	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody (HRP)
20-abx306444	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody (FITC)
20-abx306445	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody (Biotin)
20-abx306446	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody (FITC)
20-abx271148	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Stanniocalcin 1 (STC1) Antibody (Biotin)
20-abx271414	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Anti-Stanniocalcin 1/STC1 Antibody
PA1997	BosterBio	100ug/vial	EUR 294

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human)
4-PAC874Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1)

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), APC
4-PAC874Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with APC.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), Biotinylated
4-PAC874Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with Biotin.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), Cy3
4-PAC874Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with Cy3.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), FITC
4-PAC874Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with FITC.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), HRP
4-PAC874Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with HRP.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), PE
4-PAC874Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with PE.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig)
4-MAC874Hu22	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1)

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), APC-Cy7
4-PAC874Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with APC-Cy7.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), APC
4-MAC874Hu22-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with APC.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), Biotinylated
4-MAC874Hu22-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with Biotin.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), Cy3
4-MAC874Hu22-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with Cy3.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), FITC
4-MAC874Hu22-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with FITC.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), HRP
4-MAC874Hu22-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with HRP.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), PE
4-MAC874Hu22-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with PE.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), APC-Cy7
4-MAC874Hu22-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with APC-Cy7.

Human Stanniocalcin-2 (STC-2) AssayMax ELISA Kit
ES3731-1	AssayPro	96 Well Plate	EUR 417

Stc1/ Rat Stc1 ELISA Kit
ELI-29283r	Lifescience Market	96 Tests	EUR 886

STC1 ELISA KIT|Human
EF003296	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human Stanniocalcin-1,STC-1
EK3747	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

STC1 ELISA Kit (Human) (OKCD00763)
OKCD00763	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 11.6 pg/mL

STC1 ELISA Kit (Human) (OKBB00964)
OKBB00964	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Stanniocalcin-1 is a glycoprotein which is encoded by the STC1 gene. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. Human Stanniocalcin-1 is a putative molecular biomarker of leukemic microenvironment and the only molecular function known up to date is a SUMO E3 ligase activity in the SUMOylation cycle. STC1 interacts with lots of proteins in the cytoplasm, mitochondria, endoplasmatic reticulum and dot-like fashion in the nucleus. The N-terminal region of STC1 is the function region which is responsible to establish the interaction with its partners, including SUMO1. Low resolution studies shows that STC1 is an anti-parallel homodimer in solution and the cystein 202 is responsible for the dimerization of this protein. All the 5 dissulfide bonds of human STC1 are conserved and have the same profile of fish STC.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

STC-2 Stanniocalcin-2 Human Recombinant Protein
PROTO76061-1	BosterBio	Regular: 10ug	EUR 317
Description: Stanniocalcin-2 Human Recombinant produced in HEK 293 cell line is a single, glycosylated, polypeptide chain containing 289 amino acids and having a total molecular mass of 31.9kDa (calculated). The Stanniocalcin contains four extra residues which were used as a spacer and 8 residues form the C-Terminal Flag- tag.;Stanniocalcin is purified by proprietary chromatographic techniques.;The amino acid sequence of the recombinant human Stanniocalcin-2 is 100% homologous to the amino acid sequence AA 25-302 of the human mature Human Stanniocalcin-2.

Recombinant Human Stanniocalcin-1
7-02332	CHI Scientific	2µg	Ask for price

Recombinant Human Stanniocalcin-1
7-02333	CHI Scientific	10µg	Ask for price

Recombinant Human Stanniocalcin-1
7-02334	CHI Scientific	100µg	Ask for price

Stanniocalcin-1 Protein
20-abx263197	Abbexa	EUR 1483.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Human Stanniocalcin-2 (STC2) ELISA Kit
abx575647-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Stanniocalcin-2
EK2997	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human STC2/ Stanniocalcin-2 ELISA Kit
E2413Hu	Sunlong	1 Kit	EUR 605

Human STC2(Stanniocalcin-2) ELISA Kit
EH1394	FN Test	96T	EUR 567.6
Detection range: 31.2-2000 pg/ml Uniprot ID: O76061 Alias: STC2/Stanniocalcin-2/STC-2/Stanniocalcin-related protein/STC-related protein/STCRP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Stanniocalcin- 2, STC2 ELISA KIT
ELI-23671h	Lifescience Market	96 Tests	EUR 824

Human Stanniocalcin 2 (STC2) ELISA Kit
20-abx153169	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Stanniocalcin 2 (STC2) ELISA Kit
abx250668-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Stanniocalcin 2 (STC2) ELISA Kit
DLR-STC2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
DLR-STC2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Stanniocalcin-2(STC2) ELISA kit
CSB-EL022822HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Stanniocalcin-2(STC2) ELISA kit
1-CSB-EL022822HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2(STC2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Stanniocalcin 2 (STC2) ELISA Kit
RD-STC2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Stanniocalcin 2 (STC2) ELISA Kit
RD-STC2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Stanniocalcin 2 (STC2) ELISA Kit
RDR-STC2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Stanniocalcin 2 (STC2) ELISA Kit
RDR-STC2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
4-SEF913Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Stanniocalcin 2 elisa. Alternative names of the recognized antigen: STCRP Stanniocalcin-related protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse Stanniocalcin-1,STC-1
EK3748	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Stanniocalcin-1,STC-1
EK3749	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Stc1 ELISA Kit (Mouse) (OKCD01708)
OKCD01708	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 2.63 pg/mL

STC1 ELISA Kit (Rat) (OKDD00732)
OKDD00732	Aviva Systems Biology	96 Wells	EUR 1040
Description: Description of target: Calcium/phosphate-regulating protein; involved in stimulating osteoblast differentiation [rgd, feb 2006];Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.055 ng/mL

STC1 ELISA Kit (Mouse) (OKCA02193)
OKCA02193	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

Anti-Stanniocalcin 1 (1A3)
YF-MA15649	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Stanniocalcin 1

Anti-Stanniocalcin 1 (4H4)
YF-MA10890	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Stanniocalcin 1

ELISA kit for Human STC2 (Stanniocalcin 2)
E-EL-H2192	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's STC2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human STC2. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human STC2 (Stanniocalcin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human STC2 (Stanniocalcin 2)
ELK3575	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 2 (STC2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-48T	Abbkine	48T	EUR 332
Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-96T	Abbkine	96T	EUR 539
Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

STC-1 Stanniocalcin-1 Human Recombinant Protein
PROTP52823	BosterBio	Regular: 10ug	EUR 317
Description: Stanniocalcin-1 Human Recombinant produced in 293 cell line is a single, glycosylated, polypeptide chain containing 240 amino acids and having a total molecular mass of 25.9 kDa. The Stanniocalcin contains two extra residues which were used as a spacer and 8 residues form the C-Terminal Flag- tag.;Stanniocalcin is purified by proprietary chromatographic techniques.;The amino acid sequence of the recombinant human Stanniocalcin-1 is 100% homologous to the amino acid sequence AA 18-247 of the human mature Human Stanniocalcin-1.

Mouse Stanniocalcin-2 (STC2) ELISA Kit
abx515852-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Stanniocalcin-2 (STC2) ELISA Kit
abx515853-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

ELISA kit for Mouse Stanniocalcin-2
EK2995	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Stanniocalcin-2
EK2996	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Stc2/ Stanniocalcin-2 ELISA Kit
E0948Ra	Sunlong	1 Kit	EUR 646

Mouse Stc2/ Stanniocalcin-2 ELISA Kit
E1422Mo	Sunlong	1 Kit	EUR 632

Mouse Stanniocalcin- 2, Stc2 ELISA KIT
ELI-52696m	Lifescience Market	96 Tests	EUR 865

Rat Stanniocalcin- 2, Stc2 ELISA KIT
ELI-29857r	Lifescience Market	96 Tests	EUR 886

Stanniocalcin protein
30R-3175	Fitzgerald	50 ug	EUR 257
Description: Purified recombinant Stanniocalcin protein

STC1 siRNA
20-abx905324	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STC1 antibody
70R-6215	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal STC1 antibody raised against the N terminal of STC1

STC1 Antibody
ABD8393	Lifescience Market	100 ug	EUR 438

STC1 Antibody
40121-100ul	SAB	100ul	EUR 252

STC1 protein
30-1376	Fitzgerald	500 ug	EUR 392
Description: Recombinant STC1 protein

STC1 antibody
70R-20582	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal STC1 antibody

STC1 Antibody
DF8393	Affbiotech	200ul	EUR 304
Description: STC1 Antibody detects endogenous levels of total STC1.

STC1 siRNA
20-abx935425	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STC1 siRNA
20-abx935426	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STC1 Antibody
1-CSB-PA631492	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

STC1 Antibody
1-CSB-PA09889A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STC1 Antibody
1-CSB-PA022821ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STC1 Antibody
1-CSB-PA022821GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Stc2 ELISA Kit| Rat Stanniocalcin-2 ELISA Kit
EF019373	Lifescience Market	96 Tests	EUR 689

Stc2 ELISA Kit| Mouse Stanniocalcin-2 ELISA Kit
EF016296	Lifescience Market	96 Tests	EUR 689

Human Stanniocalcin 2 (STC2) CLIA Kit
20-abx495054	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Recombinant Human Stanniocalcin-2
7-02335	CHI Scientific	2µg	Ask for price

Recombinant Human Stanniocalcin-2
7-02336	CHI Scientific	10µg	Ask for price

Recombinant Human Stanniocalcin-2
7-02337	CHI Scientific	100µg	Ask for price

Human STC1 shRNA Plasmid
20-abx954638	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

STC1 Recombinant Protein (Human)
RP030376	ABM	100 ug	Ask for price

Recombinant (HEK 293) Stanniocalcin-1
RP-596	Alpha Diagnostics	10 ug	EUR 286

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

STC1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2301402	ABM	1.0 ug DNA	EUR 154

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Stanniocalcin-2 Protein
20-abx260786	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Stanniocalcin-2 Protein
20-abx263198	Abbexa	EUR 1483.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Stanniocalcin 2 Antibody
DF12324	Affbiotech	200ul	EUR 304
Description: Stanniocalcin 2 antibody detects endogenous levels of Stanniocalcin 2.

anti-Stanniocalcin 2
YF-PA15746	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Stanniocalcin 2

STC1 Conjugated Antibody
C40121	SAB	100ul	EUR 397

STC1 cloning plasmid
CSB-CL022821HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 744 Sequence: atgctccaaaactcagcagtgcttctggtgctggtgatcagtgcttctgcaacccatgaggcggagcagaatgactctgtgagccccaggaaatcccgagtggcggctcaaaactcagctgaagtggttcgttgcctcaacagtgctctacaggtcggctgcggggcttttgcatg Show more
Description: A cloning plasmid for the STC1 gene.

STC1 Polyclonal Antibody
ES11126-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against STC1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human STC1(Stanniocalcin 1) ELISA Kit