Human STC2(Stanniocalcin 2) ELISA Kit

Human STC2(Stanniocalcin 2) ELISA Kit

To Order: Contact us

Human Stanniocalcin 2 (STC2) ELISA Kit
DLR-STC2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
RD-STC2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Stanniocalcin 2 (STC2) ELISA Kit
RD-STC2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Stanniocalcin 2 (STC2) ELISA Kit
RDR-STC2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Stanniocalcin 2 (STC2) ELISA Kit
RDR-STC2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Stanniocalcin-2 (STC2) ELISA Kit
abx575647-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human STC2/ Stanniocalcin-2 ELISA Kit
E2413Hu	Sunlong	1 Kit	EUR 605

Human STC2(Stanniocalcin-2) ELISA Kit
EH1394	FN Test	96T	EUR 567.6
Detection range: 31.2-2000 pg/ml Uniprot ID: O76061 Alias: STC2/Stanniocalcin-2/STC-2/Stanniocalcin-related protein/STC-related protein/STCRP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Stanniocalcin- 2, STC2 ELISA KIT
ELI-23671h	Lifescience Market	96 Tests	EUR 824

Human Stanniocalcin 2 (STC2) ELISA Kit
20-abx153169	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Stanniocalcin 2 (STC2) ELISA Kit
abx250668-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Stanniocalcin-2(STC2) ELISA kit
CSB-EL022822HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Stanniocalcin-2(STC2) ELISA kit
1-CSB-EL022822HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2(STC2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
4-SEF913Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Stanniocalcin 2 elisa. Alternative names of the recognized antigen: STCRP Stanniocalcin-related protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Stanniocalcin-2 (STC2) ELISA Kit
abx515852-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Stanniocalcin-2 (STC2) ELISA Kit
abx515853-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Stc2/ Stanniocalcin-2 ELISA Kit
E0948Ra	Sunlong	1 Kit	EUR 646

Mouse Stc2/ Stanniocalcin-2 ELISA Kit
E1422Mo	Sunlong	1 Kit	EUR 632

Mouse Stanniocalcin- 2, Stc2 ELISA KIT
ELI-52696m	Lifescience Market	96 Tests	EUR 865

Rat Stanniocalcin- 2, Stc2 ELISA KIT
ELI-29857r	Lifescience Market	96 Tests	EUR 886

Stanniocalcin-2 (STC2) Antibody
20-abx123644	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody
20-abx126665	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody
abx145695-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Stanniocalcin 2 (STC2) Antibody
20-abx101393	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Stanniocalcin-2 (STC2) Antibody
abx025328-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody
abx025328-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody
abx027961-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody
abx027961-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Stanniocalcin 2 (STC2) Antibody
20-abx174634	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Stanniocalcin-2 (STC2) Antibody
20-abx321349	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Stanniocalcin 2 (STC2) Antibody
abx238286-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Stanniocalcin 2 (STC2) Antibody
abx238287-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Stanniocalcin 2 (STC2) Antibody
20-abx241300	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Stanniocalcin 2 (STC2)
4-RPF913Hu01	Cloud-Clone	EUR 521.12 EUR 242.00 EUR 1679.20 EUR 626.40 EUR 1152.80 EUR 412.00 EUR 4048.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O76061 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.2kDa Isoelectric Point: 7.1
Description: Recombinant Human Stanniocalcin 2 expressed in: E.coli

ELISA kit for Human STC2 (Stanniocalcin 2)
E-EL-H2192	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's STC2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human STC2. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human STC2 (Stanniocalcin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human STC2 (Stanniocalcin 2)
ELK3575	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 2 (STC2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-48T	Abbkine	48T	EUR 332
Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-96T	Abbkine	96T	EUR 539
Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Stanniocalcin 2 (STC2) CLIA Kit
20-abx495054	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Stanniocalcin 2 (STC2) Protein
20-abx069168	Abbexa	EUR 732.00 EUR 286.00 EUR 2263.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Stc2 ELISA Kit| Rat Stanniocalcin-2 ELISA Kit
EF019373	Lifescience Market	96 Tests	EUR 689

Stc2 ELISA Kit| Mouse Stanniocalcin-2 ELISA Kit
EF016296	Lifescience Market	96 Tests	EUR 689

Stanniocalcin 2 Polyclonal (STC2) Antibody
20-abx116921	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Stanniocalcin 2 (STC2) Antibody Pair
20-abx370393	Abbexa	EUR 1748.00 EUR 1121.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Anti-Stanniocalcin 2/STC2 Antibody
PA1998	BosterBio	100ug/vial	EUR 294

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse)
4-PAF913Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC2 (Ile53~Gln294) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2)

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), APC
4-PAF913Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC2 (Ile53~Gln294) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with APC.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAF913Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC2 (Ile53~Gln294) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with Biotin.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), Cy3
4-PAF913Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC2 (Ile53~Gln294) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with Cy3.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), FITC
4-PAF913Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC2 (Ile53~Gln294) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with FITC.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), HRP
4-PAF913Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC2 (Ile53~Gln294) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with HRP.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), PE
4-PAF913Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC2 (Ile53~Gln294) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with PE.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAF913Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC2 (Ile53~Gln294) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with APC-Cy7.

ELISA kit for Human Stanniocalcin-2
EK2997	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human STC2 ELISA Kit
ELA-E12206h	Lifescience Market	96 Tests	EUR 824

STC2 ELISA KIT|Human
EF000312	Lifescience Market	96 Tests	EUR 689

Human Stanniocalcin-2 (STC-2) AssayMax ELISA Kit
ES3731-1	AssayPro	96 Well Plate	EUR 417

Human STC2 PicoKine ELISA Kit
EK1988	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human STC2 in cell culture supernates, serum.

STC2 ELISA Kit (Human) (OKCD08862)
OKCD08862	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Recombinant Human Stanniocalcin-2;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 13.6pg/mL

STC2 ELISA Kit (Human) (OKEH02212)
OKEH02212	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12 pg/mL

STC2 ELISA Kit (Human) (OKBB01358)
OKBB01358	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Stanniocalcin-2 is a protein that in humans is encoded by the STC2 gene. It is mapped to 5q35.2. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <5pg/ml

ELISA kit for Mouse Stanniocalcin-2
EK2995	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Stanniocalcin-2
EK2996	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Recombinant Human Stanniocalcin-2
7-02335	CHI Scientific	2µg	Ask for price

Recombinant Human Stanniocalcin-2
7-02336	CHI Scientific	10µg	Ask for price

Recombinant Human Stanniocalcin-2
7-02337	CHI Scientific	100µg	Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Stanniocalcin-2 Protein
20-abx260786	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Stanniocalcin-2 Protein
20-abx263198	Abbexa	EUR 1483.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Stanniocalcin 2 Antibody
DF12324	Affbiotech	200ul	EUR 304
Description: Stanniocalcin 2 antibody detects endogenous levels of Stanniocalcin 2.

anti-Stanniocalcin 2
YF-PA15746	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Stanniocalcin 2

Human Stanniocalcin-2 (STC-2) Antibody
32198-05111	AssayPro	150 ug	EUR 261

Human Stanniocalcin 1 (STC1) ELISA Kit
abx576396-96tests	Abbexa	96 tests	EUR 739
Shipped within 1-3 weeks.

Human STC1/ Stanniocalcin-1 ELISA Kit
E2412Hu	Sunlong	1 Kit	EUR 605

Human Stanniocalcin- 1, STC1 ELISA KIT
ELI-41328h	Lifescience Market	96 Tests	EUR 824

Human Stanniocalcin 1 (STC1) ELISA Kit
20-abx153168	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Stanniocalcin-1(STC1) ELISA kit
CSB-EL022821HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Stanniocalcin-1(STC1) ELISA kit
1-CSB-EL022821HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
4-SEC874Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Stanniocalcin 1 ELISA Kit (STC1)
RK02343	Abclonal	96 Tests	EUR 521

Human Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse STC2 PicoKine ELISA Kit
EK1989	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse STC2 in cell culture supernates, serum and plasma (heparin).

Rat STC2 PicoKine ELISA Kit
EK1995	BosterBio	96 wells	EUR 425
Description: For quantitative detection of rat STC2 in cell culture supernates, serum and plasma (heparin).

Stc2 ELISA Kit (Mouse) (OKBB01359)
OKBB01359	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Stanniocalcin-2 is a protein that in humans is encoded by the STC2 gene. It is mapped to 11; 11 A4. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Stc2 ELISA Kit (Rat) (OKBB01365)
OKBB01365	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Stanniocalcin-2 is a protein that in humans is encoded by the STC2 gene. It is mapped to 10q12. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. STC2 has opposite effects on calcium and phosphate homeostasis as compared to Stc1.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

STC2 ELISA Kit (Mouse) (OKEH05607)
OKEH05607	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Has an anti-hypocalcemic action on calcium and phosphate homeostasis. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39 pg/mL

anti- Stanniocalcin 2 antibody
FNab08286	FN Test	100µg	EUR 585
Immunogen: stanniocalcin 2 Uniprot ID: O76061 Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against Stanniocalcin 2

anti- Stanniocalcin 2 antibody
FNab08287	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: stanniocalcin 2 Uniprot ID: O76061 Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against Stanniocalcin 2

Stanniocalcin 2 Blocking Peptide
DF12324-BP	Affbiotech	1mg	EUR 195

Anti-Stanniocalcin 2 antibody
PAab08286	Lifescience Market	100 ug	EUR 412

Anti-Stanniocalcin 2 (2B11)
YF-MA16451	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Stanniocalcin 2

STC-2 Stanniocalcin-2 Human Recombinant Protein
PROTO76061-1	BosterBio	Regular: 10ug	EUR 317
Description: Stanniocalcin-2 Human Recombinant produced in HEK 293 cell line is a single, glycosylated, polypeptide chain containing 289 amino acids and having a total molecular mass of 31.9kDa (calculated). The Stanniocalcin contains four extra residues which were used as a spacer and 8 residues form the C-Terminal Flag- tag.;Stanniocalcin is purified by proprietary chromatographic techniques.;The amino acid sequence of the recombinant human Stanniocalcin-2 is 100% homologous to the amino acid sequence AA 25-302 of the human mature Human Stanniocalcin-2.

Human Stanniocalcin 1/STC1 PicoKine ELISA Kit
EK1404	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human STC1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

ELISA kit for Human STC1 (Stanniocalcin 1)
ELK3332	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-48T	Abbkine	48T	EUR 332
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-96T	Abbkine	96T	EUR 539
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

STC2 siRNA
20-abx905325	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STC2 Antibody
40339-100ul	SAB	100ul	EUR 252

STC2 antibody
70R-20583	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal STC2 antibody

STC2 siRNA
20-abx935427	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STC2 siRNA
20-abx935428	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STC2 Antibody
1-CSB-PA212583	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

STC2 Antibody
1-CSB-PA022822ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STC2 Antibody
1-CSB-PA022822GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

pOTB7-STC2
PVT18772	Lifescience Market	2 ug	EUR 231

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Recombinant (HEK 293) Stanniocalcin-2
RP-609	Alpha Diagnostics	10 ug	EUR 347

STC2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2301503	ABM	1.0 ug DNA	EUR 154

Human Stanniocalcin-2 (STC-2) Antibody (Biotin Conjugate)
32198-05121	AssayPro	150 ug	EUR 369

Cow Stanniocalcin 1 (STC1) ELISA Kit
abx555794-96tests	Abbexa	96 tests	EUR 911
Shipped within 1-3 weeks.

Rat Stanniocalcin 1 (STC1) ELISA Kit
abx571149-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
abx576405-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Bovine Stanniocalcin- 1, STC1 ELISA KIT
ELI-13825b	Lifescience Market	96 Tests	EUR 928

Mouse Stanniocalcin- 1, Stc1 ELISA KIT
ELI-39536m	Lifescience Market	96 Tests	EUR 865

Rat Stanniocalcin 1 (STC1) ELISA Kit
20-abx156121	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
20-abx154711	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Mouse Stanniocalcin-1(STC1) ELISA kit
CSB-EL022821MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Stanniocalcin-1(STC1) ELISA kit
1-CSB-EL022821MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
4-SEC874Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
4-SEC874Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Stanniocalcin 1 (STC1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Stanniocalcin 1 ELISA Kit (STC1)
RK03214	Abclonal	96 Tests	EUR 521

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human STC2 shRNA Plasmid
20-abx955660	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

STC2 Recombinant Protein (Human)
RP030379	ABM	100 ug	Ask for price

Stanniocalcin protein
30R-3175	Fitzgerald	50 ug	EUR 257
Description: Purified recombinant Stanniocalcin protein

Stc1 ELISA Kit| Rat Stanniocalcin-1 ELISA Kit
EF019372	Lifescience Market	96 Tests	EUR 689

Stc1 ELISA Kit| Mouse Stanniocalcin-1 ELISA Kit
EF016295	Lifescience Market	96 Tests	EUR 689

STC1 ELISA Kit| Bovine Stanniocalcin-1 ELISA Kit
EF011935	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human Stanniocalcin-1,STC-1
EK3747	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Stanniocalcin 1 (STC1) CLIA Kit
20-abx493944	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Recombinant Human Stanniocalcin-1
7-02332	CHI Scientific	2µg	Ask for price

Recombinant Human Stanniocalcin-1
7-02333	CHI Scientific	10µg	Ask for price

Recombinant Human Stanniocalcin-1
7-02334	CHI Scientific	100µg	Ask for price

Human Stanniocalcin-1 (STC1)
1-CSB-RP098854h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 50.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli

Human Stanniocalcin-1 (STC1)
1-CSB-RP098874HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 39.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli

Human Stanniocalcin-2 (STC-2) AssayLite Antibody (FITC Conjugate)
32198-05141	AssayPro	150 ug	EUR 428

Human Stanniocalcin-2 (STC-2) AssayLite Antibody (RPE Conjugate)
32198-05151	AssayPro	150 ug	EUR 428

Human Stanniocalcin-2 (STC-2) AssayLite Antibody (APC Conjugate)
32198-05161	AssayPro	150 ug	EUR 428

Human Stanniocalcin-2 (STC-2) AssayLite Antibody (PerCP Conjugate)
32198-05171	AssayPro	150 ug	EUR 471

STC-2 Stanniocalcin-2 Human Recombinant Protein, His Tag
PROTO76061	BosterBio	Regular: 20ug	EUR 317
Description: STC 2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 301 amino acids (25-302 a.a.) and having a molecular mass of 33kDa. STC 2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

STC2 Conjugated Antibody
C40339	SAB	100ul	EUR 397

STC2 cloning plasmid
CSB-CL022822HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 909 Sequence: atgtgtgccgagcggctgggccagttcatgaccctggctttggtgttggccacctttgacccggcgcgggggaccgacgccaccaacccacccgagggtccccaagacaggagctcccagcagaaaggccgcctgtccctgcagaatacagcggagatccagcactgtttggtcaa Show more
Description: A cloning plasmid for the STC2 gene.

STC2 Polyclonal Antibody
ES11240-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against STC2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

STC2 Polyclonal Antibody
ES11240-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against STC2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

STC2 Polyclonal Antibody
ABP60538-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250 Applications tips:
Description: A polyclonal antibody for detection of STC2 from Human, Mouse, Rat. This STC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250

STC2 Polyclonal Antibody
ABP60538-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250 Applications tips:
Description: A polyclonal antibody for detection of STC2 from Human, Mouse, Rat. This STC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250

STC2 Polyclonal Antibody
ABP60538-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250 Applications tips:
Description: A polyclonal antibody for detection of STC2 from Human, Mouse, Rat. This STC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250

STC2 Rabbit pAb
A10397-100ul	Abclonal	100 ul	EUR 308

STC2 Rabbit pAb
A10397-200ul	Abclonal	200 ul	EUR 459

STC2 Rabbit pAb
A10397-20ul	Abclonal	20 ul	EUR 183

STC2 Rabbit pAb
A10397-50ul	Abclonal	50 ul	EUR 223

STC2 Rabbit pAb
A8626-100ul	Abclonal	100 ul	EUR 308

STC2 Rabbit pAb
A8626-200ul	Abclonal	200 ul	EUR 459

STC2 Rabbit pAb
A8626-20ul	Abclonal	20 ul	Ask for price

STC2 Rabbit pAb
A8626-50ul	Abclonal	50 ul	Ask for price

Anti-STC2 antibody
STJ111349	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.

Anti-STC2 antibody
STJ112433	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.

Anti-STC2 antibody
STJ192398	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to STC2

ELISA kit for Mouse STC1 (Stanniocalcin 1)
ELK6277	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat STC1 (Stanniocalcin 1)
ELK6427	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-48T	Abbkine	48T	EUR 332
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-96T	Abbkine	96T	EUR 539
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-48T	Abbkine	48T	EUR 332
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-96T	Abbkine	96T	EUR 539
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

STC2 ORF Vector (Human) (pORF)
ORF010127	ABM	1.0 ug DNA	EUR 95

Stanniocalcin-1 Protein
20-abx263197	Abbexa	EUR 1483.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Stc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3773803	ABM	1.0 ug DNA	EUR 154

Stc2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6918303	ABM	1.0 ug DNA	EUR 154

Human Stanniocalcin 1 (STC1) Protein
20-abx069167	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

ELISA kit for Mouse Stanniocalcin-1,STC-1
EK3748	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Stanniocalcin-1,STC-1
EK3749	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Rat STC2 shRNA Plasmid
20-abx986108	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

STC2 protein (His tag)
80R-2847	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant STC2 protein (His tag)

Human STC2(Stanniocalcin 2) ELISA Kit