Human STC2(Stanniocalcin 2) ELISA Kit

Human STC2(Stanniocalcin 2) ELISA Kit

To Order: Contact us

Human Stanniocalcin 2 (STC2) ELISA Kit
DLR-STC2-Hu-96T 96T
EUR 673
  • Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Stanniocalcin 2 (STC2) ELISA Kit
RD-STC2-Hu-48Tests 48 Tests
EUR 521
Human Stanniocalcin 2 (STC2) ELISA Kit
RD-STC2-Hu-96Tests 96 Tests
EUR 723
Human Stanniocalcin 2 (STC2) ELISA Kit
RDR-STC2-Hu-48Tests 48 Tests
EUR 544
Human Stanniocalcin 2 (STC2) ELISA Kit
RDR-STC2-Hu-96Tests 96 Tests
EUR 756
Human Stanniocalcin-2 (STC2) ELISA Kit
abx575647-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human STC2/ Stanniocalcin-2 ELISA Kit
E2413Hu 1 Kit
EUR 605
Human STC2(Stanniocalcin-2) ELISA Kit
EH1394 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: O76061
  • Alias: STC2/Stanniocalcin-2/STC-2/Stanniocalcin-related protein/STC-related protein/STCRP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml
Human Stanniocalcin- 2, STC2 ELISA KIT
ELI-23671h 96 Tests
EUR 824
Human Stanniocalcin 2 (STC2) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Stanniocalcin 2 (STC2) ELISA Kit
abx250668-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Stanniocalcin-2(STC2) ELISA kit
CSB-EL022822HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Stanniocalcin-2(STC2) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2(STC2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Stanniocalcin 2 (STC2) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stanniocalcin 2 elisa. Alternative names of the recognized antigen: STCRP
  • Stanniocalcin-related protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Stanniocalcin-2 (STC2) ELISA Kit
abx515852-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Rat Stanniocalcin-2 (STC2) ELISA Kit
abx515853-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Rat Stc2/ Stanniocalcin-2 ELISA Kit
E0948Ra 1 Kit
EUR 646
Mouse Stc2/ Stanniocalcin-2 ELISA Kit
E1422Mo 1 Kit
EUR 632
Mouse Stanniocalcin- 2, Stc2 ELISA KIT
ELI-52696m 96 Tests
EUR 865
Rat Stanniocalcin- 2, Stc2 ELISA KIT
ELI-29857r 96 Tests
EUR 886
Stanniocalcin-2 (STC2) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Stanniocalcin-2 (STC2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Stanniocalcin-2 (STC2) Antibody
abx145695-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Stanniocalcin 2 (STC2) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Stanniocalcin-2 (STC2) Antibody
abx025328-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Stanniocalcin-2 (STC2) Antibody
abx025328-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Stanniocalcin-2 (STC2) Antibody
abx027961-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Stanniocalcin-2 (STC2) Antibody
abx027961-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Stanniocalcin 2 (STC2) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Stanniocalcin-2 (STC2) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Stanniocalcin 2 (STC2) Antibody
abx238286-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Stanniocalcin 2 (STC2) Antibody
abx238287-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Stanniocalcin 2 (STC2) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Stanniocalcin 2 (STC2)
  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O76061
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.2kDa
  • Isoelectric Point: 7.1
Description: Recombinant Human Stanniocalcin 2 expressed in: E.coli
ELISA kit for Human STC2 (Stanniocalcin 2)
E-EL-H2192 1 plate of 96 wells
EUR 534
  • Gentaur's STC2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human STC2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human STC2 (Stanniocalcin 2) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human STC2 (Stanniocalcin 2)
ELK3575 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 2 (STC2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
  • Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-48T 48T
EUR 332
  • Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-96T 96T
EUR 539
  • Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Stanniocalcin 2 (STC2) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Stanniocalcin 2 (STC2) Protein
  • EUR 732.00
  • EUR 286.00
  • EUR 2263.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Stc2 ELISA Kit| Rat Stanniocalcin-2 ELISA Kit
EF019373 96 Tests
EUR 689
Stc2 ELISA Kit| Mouse Stanniocalcin-2 ELISA Kit
EF016296 96 Tests
EUR 689
Stanniocalcin 2 Polyclonal (STC2) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Stanniocalcin 2 (STC2) Antibody Pair
  • EUR 1748.00
  • EUR 1121.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.
Anti-Stanniocalcin 2/STC2 Antibody
PA1998 100ug/vial
EUR 294
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2)
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with APC.
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with Biotin.
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with Cy3.
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with FITC.
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with HRP.
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with PE.
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with APC-Cy7.
ELISA kit for Human Stanniocalcin-2
EK2997 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human STC2 ELISA Kit
ELA-E12206h 96 Tests
EUR 824
EF000312 96 Tests
EUR 689
Human Stanniocalcin-2 (STC-2) AssayMax ELISA Kit
ES3731-1 96 Well Plate
EUR 417
Human STC2 PicoKine ELISA Kit
EK1988 96 wells
EUR 425
Description: For quantitative detection of human STC2 in cell culture supernates, serum.
STC2 ELISA Kit (Human) (OKCD08862)
OKCD08862 96 Wells
EUR 975
Description: Description of target: Recombinant Human Stanniocalcin-2;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 13.6pg/mL
STC2 ELISA Kit (Human) (OKEH02212)
OKEH02212 96 Wells
EUR 662
Description: Description of target: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12 pg/mL
STC2 ELISA Kit (Human) (OKBB01358)
OKBB01358 96 Wells
EUR 505
Description: Description of target: Stanniocalcin-2 is a protein that in humans is encoded by the STC2 gene. It is mapped to 5q35.2. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <5pg/ml
ELISA kit for Mouse Stanniocalcin-2
EK2995 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Rat Stanniocalcin-2
EK2996 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.
Recombinant Human Stanniocalcin-2
7-02335 2µg Ask for price
Recombinant Human Stanniocalcin-2
7-02336 10µg Ask for price
Recombinant Human Stanniocalcin-2
7-02337 100µg Ask for price
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Stanniocalcin-2 Protein
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Stanniocalcin-2 Protein
  • EUR 1483.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.
Stanniocalcin 2 Antibody
DF12324 200ul
EUR 304
Description: Stanniocalcin 2 antibody detects endogenous levels of Stanniocalcin 2.
anti-Stanniocalcin 2
YF-PA15746 50 ul
EUR 363
Description: Mouse polyclonal to Stanniocalcin 2
Human Stanniocalcin-2 (STC-2) Antibody
32198-05111 150 ug
EUR 261
Human Stanniocalcin 1 (STC1) ELISA Kit
abx576396-96tests 96 tests
EUR 739
  • Shipped within 1-3 weeks.
Human STC1/ Stanniocalcin-1 ELISA Kit
E2412Hu 1 Kit
EUR 605
Human Stanniocalcin- 1, STC1 ELISA KIT
ELI-41328h 96 Tests
EUR 824
Human Stanniocalcin 1 (STC1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Hu-48T 48T
EUR 517
  • Should the Human Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Hu-96T 96T
EUR 673
  • Should the Human Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Stanniocalcin-1(STC1) ELISA kit
CSB-EL022821HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Stanniocalcin-1(STC1) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Stanniocalcin 1 (STC1) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Stanniocalcin 1 ELISA Kit (STC1)
RK02343 96 Tests
EUR 521
Human Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Hu-48Tests 48 Tests
EUR 521
Human Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Hu-96Tests 96 Tests
EUR 723
Human Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Hu-48Tests 48 Tests
EUR 544
Human Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Hu-96Tests 96 Tests
EUR 756
Mouse STC2 PicoKine ELISA Kit
EK1989 96 wells
EUR 425
Description: For quantitative detection of mouse STC2 in cell culture supernates, serum and plasma (heparin).
Rat STC2 PicoKine ELISA Kit
EK1995 96 wells
EUR 425
Description: For quantitative detection of rat STC2 in cell culture supernates, serum and plasma (heparin).
Stc2 ELISA Kit (Mouse) (OKBB01359)
OKBB01359 96 Wells
EUR 505
Description: Description of target: Stanniocalcin-2 is a protein that in humans is encoded by the STC2 gene. It is mapped to 11; 11 A4. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml
Stc2 ELISA Kit (Rat) (OKBB01365)
OKBB01365 96 Wells
EUR 505
Description: Description of target: Stanniocalcin-2 is a protein that in humans is encoded by the STC2 gene. It is mapped to 10q12. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. STC2 has opposite effects on calcium and phosphate homeostasis as compared to Stc1.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml
STC2 ELISA Kit (Mouse) (OKEH05607)
OKEH05607 96 Wells
EUR 779
Description: Description of target: Has an anti-hypocalcemic action on calcium and phosphate homeostasis. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39 pg/mL
anti- Stanniocalcin 2 antibody
FNab08286 100µg
EUR 585
  • Immunogen: stanniocalcin 2
  • Uniprot ID: O76061
  • Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against Stanniocalcin 2
anti- Stanniocalcin 2 antibody
FNab08287 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: stanniocalcin 2
  • Uniprot ID: O76061
  • Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against Stanniocalcin 2
Stanniocalcin 2 Blocking Peptide
DF12324-BP 1mg
EUR 195
Anti-Stanniocalcin 2 antibody
PAab08286 100 ug
EUR 412
Anti-Stanniocalcin 2 (2B11)
YF-MA16451 100 ug
EUR 363
Description: Mouse monoclonal to Stanniocalcin 2
STC-2 Stanniocalcin-2 Human Recombinant Protein
PROTO76061-1 Regular: 10ug
EUR 317
Description: Stanniocalcin-2 Human Recombinant produced in HEK 293 cell line is a single, glycosylated, polypeptide chain containing 289 amino acids and having a total molecular mass of 31.9kDa (calculated). The Stanniocalcin contains four extra residues which were used as a spacer and 8 residues form the C-Terminal Flag- tag.;Stanniocalcin is purified by proprietary chromatographic techniques.;The amino acid sequence of the recombinant human Stanniocalcin-2 is 100% homologous to the amino acid sequence AA 25-302 of the human mature Human Stanniocalcin-2.
Human Stanniocalcin 1/STC1 PicoKine ELISA Kit
EK1404 96 wells
EUR 425
Description: For quantitative detection of human STC1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
ELISA kit for Human STC1 (Stanniocalcin 1)
ELK3332 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
  • Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-48T 48T
EUR 332
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-96T 96T
EUR 539
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STC2 Antibody
40339-100ul 100ul
EUR 252
STC2 antibody
70R-20583 50 ul
EUR 435
Description: Rabbit polyclonal STC2 antibody
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STC2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
STC2 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
STC2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
PVT18772 2 ug
EUR 231
AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Recombinant (HEK 293) Stanniocalcin-2
RP-609 10 ug
EUR 347
STC2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2301503 1.0 ug DNA
EUR 154
Human Stanniocalcin-2 (STC-2) Antibody (Biotin Conjugate)
32198-05121 150 ug
EUR 369
Cow Stanniocalcin 1 (STC1) ELISA Kit
abx555794-96tests 96 tests
EUR 911
  • Shipped within 1-3 weeks.
Rat Stanniocalcin 1 (STC1) ELISA Kit
abx571149-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.
Mouse Stanniocalcin 1 (STC1) ELISA Kit
abx576405-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.
Bovine Stanniocalcin- 1, STC1 ELISA KIT
ELI-13825b 96 Tests
EUR 928
Mouse Stanniocalcin- 1, Stc1 ELISA KIT
ELI-39536m 96 Tests
EUR 865
Rat Stanniocalcin 1 (STC1) ELISA Kit
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Stanniocalcin 1 (STC1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Mu-48T 48T
EUR 527
  • Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.
Mouse Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Mu-96T 96T
EUR 688
  • Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.
Rat Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Ra-48T 48T
EUR 549
  • Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.
Rat Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Ra-96T 96T
EUR 718
  • Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.
Mouse Stanniocalcin-1(STC1) ELISA kit
CSB-EL022821MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Stanniocalcin-1(STC1) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Stanniocalcin 1 (STC1) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.
Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.
Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.
Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.
Rat Stanniocalcin 1 (STC1) ELISA Kit
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Stanniocalcin 1 (STC1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.
Mouse Stanniocalcin 1 ELISA Kit (STC1)
RK03214 96 Tests
EUR 521
Mouse Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Mu-48Tests 48 Tests
EUR 533
Mouse Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Mu-96Tests 96 Tests
EUR 740
Rat Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Ra-48Tests 48 Tests
EUR 557
Rat Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Ra-96Tests 96 Tests
EUR 775
Mouse Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Mu-48Tests 48 Tests
EUR 557
Mouse Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Mu-96Tests 96 Tests
EUR 774
Rat Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Ra-48Tests 48 Tests
EUR 583
Rat Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Ra-96Tests 96 Tests
EUR 811
Human STC2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
STC2 Recombinant Protein (Human)
RP030379 100 ug Ask for price
Stanniocalcin protein
30R-3175 50 ug
EUR 257
Description: Purified recombinant Stanniocalcin protein
Stc1 ELISA Kit| Rat Stanniocalcin-1 ELISA Kit
EF019372 96 Tests
EUR 689
Stc1 ELISA Kit| Mouse Stanniocalcin-1 ELISA Kit
EF016295 96 Tests
EUR 689
STC1 ELISA Kit| Bovine Stanniocalcin-1 ELISA Kit
EF011935 96 Tests
EUR 689
ELISA kit for Human Stanniocalcin-1,STC-1
EK3747 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human Stanniocalcin 1 (STC1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Recombinant Human Stanniocalcin-1
7-02332 2µg Ask for price
Recombinant Human Stanniocalcin-1
7-02333 10µg Ask for price
Recombinant Human Stanniocalcin-1
7-02334 100µg Ask for price
Human Stanniocalcin-1 (STC1)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli
Human Stanniocalcin-1 (STC1)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli
Human Stanniocalcin-2 (STC-2) AssayLite Antibody (FITC Conjugate)
32198-05141 150 ug
EUR 428
Human Stanniocalcin-2 (STC-2) AssayLite Antibody (RPE Conjugate)
32198-05151 150 ug
EUR 428
Human Stanniocalcin-2 (STC-2) AssayLite Antibody (APC Conjugate)
32198-05161 150 ug
EUR 428
Human Stanniocalcin-2 (STC-2) AssayLite Antibody (PerCP Conjugate)
32198-05171 150 ug
EUR 471
STC-2 Stanniocalcin-2 Human Recombinant Protein, His Tag
PROTO76061 Regular: 20ug
EUR 317
Description: STC 2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 301 amino acids (25-302 a.a.) and having a molecular mass of 33kDa. STC 2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
STC2 Conjugated Antibody
C40339 100ul
EUR 397
STC2 cloning plasmid
CSB-CL022822HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 909
  • Sequence: atgtgtgccgagcggctgggccagttcatgaccctggctttggtgttggccacctttgacccggcgcgggggaccgacgccaccaacccacccgagggtccccaagacaggagctcccagcagaaaggccgcctgtccctgcagaatacagcggagatccagcactgtttggtcaa
  • Show more
Description: A cloning plasmid for the STC2 gene.
STC2 Polyclonal Antibody
ES11240-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STC2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
STC2 Polyclonal Antibody
ES11240-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STC2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
STC2 Polyclonal Antibody
ABP60538-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of STC2 from Human, Mouse, Rat. This STC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250
STC2 Polyclonal Antibody
ABP60538-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of STC2 from Human, Mouse, Rat. This STC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250
STC2 Polyclonal Antibody
ABP60538-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of STC2 from Human, Mouse, Rat. This STC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC2 protein at amino acid sequence of 170-250
STC2 Rabbit pAb
A10397-100ul 100 ul
EUR 308
STC2 Rabbit pAb
A10397-200ul 200 ul
EUR 459
STC2 Rabbit pAb
A10397-20ul 20 ul
EUR 183
STC2 Rabbit pAb
A10397-50ul 50 ul
EUR 223
STC2 Rabbit pAb
A8626-100ul 100 ul
EUR 308
STC2 Rabbit pAb
A8626-200ul 200 ul
EUR 459
STC2 Rabbit pAb
A8626-20ul 20 ul Ask for price
STC2 Rabbit pAb
A8626-50ul 50 ul Ask for price
Anti-STC2 antibody
STJ111349 100 µl
EUR 277
Description: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.
Anti-STC2 antibody
STJ112433 100 µl
EUR 277
Description: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.
Anti-STC2 antibody
STJ192398 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STC2
ELISA kit for Mouse STC1 (Stanniocalcin 1)
ELK6277 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
  • Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Rat STC1 (Stanniocalcin 1)
ELK6427 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
  • Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-48T 48T
EUR 332
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-96T 96T
EUR 539
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-48T 48T
EUR 332
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-96T 96T
EUR 539
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
STC2 ORF Vector (Human) (pORF)
ORF010127 1.0 ug DNA
EUR 95
Stanniocalcin-1 Protein
  • EUR 1483.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Stc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3773803 1.0 ug DNA
EUR 154
Stc2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6918303 1.0 ug DNA
EUR 154
Human Stanniocalcin 1 (STC1) Protein
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
ELISA kit for Mouse Stanniocalcin-1,STC-1
EK3748 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Rat Stanniocalcin-1,STC-1
EK3749 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Rat STC2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
STC2 protein (His tag)
80R-2847 100 ug
EUR 327
Description: Purified recombinant STC2 protein (His tag)

Human STC2(Stanniocalcin 2) ELISA Kit