Human TNMD(Tenomodulin) ELISA Kit

Human TNMD(Tenomodulin) ELISA Kit

To Order: Contact us

Human Tenomodulin (TNMD) ELISA Kit
RDR-TNMD-Hu-96Tests 96 Tests
EUR 756

Human Tenomodulin (TNMD) ELISA Kit
RD-TNMD-Hu-48Tests 48 Tests
EUR 521

Human Tenomodulin (TNMD) ELISA Kit
RD-TNMD-Hu-96Tests 96 Tests
EUR 723

Human Tenomodulin(TNMD) ELISA kit
CSB-EL024007HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tenomodulin (TNMD) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tenomodulin(TNMD) ELISA kit
1-CSB-EL024007HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tenomodulin(TNMD) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Tenomodulin (TNMD) ELISA Kit
20-abx153249
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tenomodulin (TNMD) ELISA Kit
abx250350-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human TNMD/ Tenomodulin ELISA Kit
E2556Hu 1 Kit
EUR 571

Human TNMD(Tenomodulin) ELISA Kit
EH1104 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q9H2S6
  • Alias: TNMD(Tenomodulin)/UNQ771/CHM1L/TeM/hTeM/Tendin/Myodulin/Chondromodulin-1-like protein/Chondromodulin-I-like protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Tenomodulin, TNMD ELISA KIT
ELI-03188h 96 Tests
EUR 824

Human Tenomodulin (TNMD) ELISA Kit
abx572549-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Tenomodulin(TNMD)ELISA Kit
QY-E02852 96T
EUR 361

Human Tenomodulin (TNMD) ELISA Kit
SEC798Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.

Human Tenomodulin (TNMD) ELISA Kit
SEC798Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.

Human Tenomodulin (TNMD) ELISA Kit
SEC798Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.

Human Tenomodulin (TNMD) ELISA Kit
SEC798Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.

Human Tenomodulin (TNMD) ELISA Kit
4-SEC798Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tenomodulin elisa. Alternative names of the recognized antigen: TEM
  • BRICD4
  • CHM1-LIKE
  • CHM1L
  • Myodulin
  • Tendin
  • Chondromodulin-1-like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tenomodulin (TNMD) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Tenomodulin(TNMD) ELISA kit
CSB-EL024007MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Tenomodulin (TNMD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Tenomodulin(TNMD) ELISA kit
1-CSB-EL024007MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Tenomodulin(TNMD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Tenomodulin (TNMD) ELISA Kit
abx256381-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Tnmd/ Tenomodulin ELISA Kit
E0991Ra 1 Kit
EUR 571

Mouse Tenomodulin, Tnmd ELISA KIT
ELI-03189m 96 Tests
EUR 865

Mouse Tenomodulin (TNMD) ELISA Kit
abx514514-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Tnmd(Tenomodulin) ELISA Kit
ER0403 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9ESC2
  • Alias: TNMD(Tenomodulin)/UNQ771/CHM1L/TeM/hTeM/Tendin/Myodulin/Chondromodulin-1-like protein/Chondromodulin-I-like protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Mouse Tenomodulin (Tnmd)
1-CSB-EP024007MO
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 35.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Tenomodulin(Tnmd),partial expressed in E.coli

Mouse Tenomodulin (Tnmd)
1-CSB-YP324007MO
  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Tenomodulin(Tnmd),partial expressed in Yeast

Tenomodulin (TNMD) Antibody
abx026953-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tenomodulin (TNMD) Antibody
abx026953-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tenomodulin (TNMD) Antibody
20-abx178548
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tenomodulin (TNMD) Antibody
20-abx174740
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tenomodulin (TNMD) Antibody
20-abx338730
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Human TNMD (Tenomodulin)
ELK3581 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tenomodulin (TNMD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tenomodulin (TN
  • Show more
Description: A sandwich ELISA kit for detection of Tenomodulin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Tenomodulin (TNMD)
KTE60192-48T 48T
EUR 332
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tenomodulin (TNMD)
KTE60192-5platesof96wells 5 plates of 96 wells
EUR 2115
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tenomodulin (TNMD)
KTE60192-96T 96T
EUR 539
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Tenomodulin (TNMD) CLIA Kit
20-abx493907
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Tenomodulin (TNMD) Protein
20-abx655206
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Rat Tenomodulin (TNMD)
KTE100063-48T 48T
EUR 332
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Tenomodulin (TNMD)
KTE100063-5platesof96wells 5 plates of 96 wells
EUR 2115
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Tenomodulin (TNMD)
KTE100063-96T 96T
EUR 539
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tenomodulin (TNMD)
KTE70104-48T 48T
EUR 332
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tenomodulin (TNMD)
KTE70104-5platesof96wells 5 plates of 96 wells
EUR 2115
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tenomodulin (TNMD)
KTE70104-96T 96T
EUR 539
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tnmd ELISA Kit| Rat Tenomodulin ELISA Kit
EF017252 96 Tests
EUR 689

Tenomodulin (TNMD) Antibody (HRP)
20-abx337925
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tenomodulin (TNMD) Antibody (FITC)
20-abx337926
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tenomodulin (TNMD) Antibody (Biotin)
20-abx337927
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tnmd/ Rat Tnmd ELISA Kit
ELI-03190r 96 Tests
EUR 886

Human TNMD ELISA Kit
ELA-E0989h 96 Tests
EUR 824

TNMD ELISA KIT|Human
EF001697 96 Tests
EUR 689

ELISA kit for Human Tenomodulin
EK2501 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Tenomodulin in samples from serum, plasma, tissue homogenates and other biological fluids.

TNMD ELISA Kit (Human) (OKCD08258)
OKCD08258 96 Wells
EUR 975
Description: Description of target: TNMD is a single-pass type II membrane proteinPotential. It belongs to the chondromodulin-1 family and contains 1 BRICHOS domain. TNMD may be an angiogenesis inhibitor.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.114ng/mL

Tenomodulin antibody
70R-6905 50 ug
EUR 467
Description: Rabbit polyclonal Tenomodulin antibody raised against the N terminal of TNMD

Tenomodulin antibody
70R-6317 50 ug
EUR 467
Description: Rabbit polyclonal Tenomodulin antibody raised against the middle region of TNMD

TNMD ELISA Kit (Mouse) (OKCA02464)
OKCA02464 96 Wells
EUR 846
Description: Description of target: May be an angiogenesis inhibitor. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 2.34 pg/mL

TNMD ELISA Kit (Mouse) (OKEH05757)
OKEH05757 96 Wells
EUR 662
Description: Description of target: May be an angiogenesis inhibitor. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.088 ng/mL

TNMD ELISA Kit (Rat) (OKEH04398)
OKEH04398 96 Wells
EUR 662
Description: Description of target: transmembrane protein; may be an angiogenesis inhibitor; may play a regulatory role in eye and skeletal muscle development [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.089 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

TNMD Antibody
43641-100ul 100ul
EUR 252

TNMD Antibody
1-CSB-PA024007LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

TNMD siRNA
20-abx905713
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNMD siRNA
20-abx937662
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNMD siRNA
20-abx937663
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Tenomodulin Blocking Peptide
33R-4477 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNMD antibody, catalog no. 70R-6905

Tenomodulin Blocking Peptide
33R-7661 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNMD antibody, catalog no. 70R-6317

Human TNMD shRNA Plasmid
20-abx961920
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TNMD Recombinant Protein (Human)
RP032482 100 ug Ask for price

TNMD Conjugated Antibody
C43641 100ul
EUR 397

TNMD cloning plasmid
CSB-CL024007HU-10ug 10ug
EUR 285
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 624
  • Sequence: atggcaaagaatcctccagagaattgtgaagactgtcacattctaaatgcagaagcttttaaatccaagaaaatatgtaaatcacttaagatttgtggactggtgtttggtatcctggccctaactctaattgtcctgttttgggggagcaagcacttctggccggaggtacccaa
  • Show more
Description: A cloning plasmid for the TNMD gene.

TNMD Rabbit pAb
A17753-100ul 100 ul
EUR 308

TNMD Rabbit pAb
A17753-200ul 200 ul
EUR 459

TNMD Rabbit pAb
A17753-20ul 20 ul
EUR 183

TNMD Rabbit pAb
A17753-50ul 50 ul
EUR 223

Recombinant mouse Tnmd
P1421 100ug Ask for price
  • Uniprot ID: Q9EP64
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for mouse Tnmd

Anti-TNMD antibody
STJ119792 100 µl
EUR 277
Description: This gene encodes a protein that is related to chondromodulin-I, which is a cartilage-specific glycoprotein that functions to stimulate chondrocyte growth and to inhibit tube formation of endothelial cells. This protein is also an angiogenesis inhibitor. Genetic variation in this gene is associated with a risk for type 2 diabetes, central obesity and serum levels of systemic immune mediators in a body size-dependent manner. This gene is also a candidate gene for age-related macular degeneration, though a direct link has yet to be demonstrated. [provided by RefSeq, Sep 2009]

TNMD ORF Vector (Human) (pORF)
ORF010828 1.0 ug DNA
EUR 95

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Polyclonal TNMD Antibody (Center)
APR03728G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNMD (Center). This antibody is tested and proven to work in the following applications:

Mouse TNMD shRNA Plasmid
20-abx975257
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TNMD shRNA Plasmid
20-abx986157
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TNMD Antibody, HRP conjugated
1-CSB-PA024007LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TNMD Antibody, FITC conjugated
1-CSB-PA024007LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TNMD Antibody, Biotin conjugated
1-CSB-PA024007LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TNMD Recombinant Protein (Rat)
RP234134 100 ug Ask for price

TNMD Recombinant Protein (Mouse)
RP180350 100 ug Ask for price

PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266

TNMD sgRNA CRISPR Lentivector set (Human)
K2419001 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Tnmd ORF Vector (Rat) (pORF)
ORF078046 1.0 ug DNA
EUR 506

Tnmd ORF Vector (Mouse) (pORF)
ORF060118 1.0 ug DNA
EUR 506

TNMD sgRNA CRISPR Lentivector (Human) (Target 1)
K2419002 1.0 ug DNA
EUR 154

TNMD sgRNA CRISPR Lentivector (Human) (Target 2)
K2419003 1.0 ug DNA
EUR 154

TNMD sgRNA CRISPR Lentivector (Human) (Target 3)
K2419004 1.0 ug DNA
EUR 154

TNMD Protein Vector (Human) (pPB-C-His)
PV043309 500 ng
EUR 329

TNMD Protein Vector (Human) (pPB-N-His)
PV043310 500 ng
EUR 329

TNMD Protein Vector (Human) (pPM-C-HA)
PV043311 500 ng
EUR 329

TNMD Protein Vector (Human) (pPM-C-His)
PV043312 500 ng
EUR 329

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Tnmd sgRNA CRISPR Lentivector set (Rat)
K6960501 3 x 1.0 ug
EUR 339

Tnmd sgRNA CRISPR Lentivector set (Mouse)
K3684001 3 x 1.0 ug
EUR 339

vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

Tnmd sgRNA CRISPR Lentivector (Rat) (Target 1)
K6960502 1.0 ug DNA
EUR 154

Tnmd sgRNA CRISPR Lentivector (Rat) (Target 2)
K6960503 1.0 ug DNA
EUR 154

Tnmd sgRNA CRISPR Lentivector (Rat) (Target 3)
K6960504 1.0 ug DNA
EUR 154

Tnmd sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3684002 1.0 ug DNA
EUR 154

Tnmd sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3684003 1.0 ug DNA
EUR 154

Tnmd sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3684004 1.0 ug DNA
EUR 154

TNMD Protein Vector (Rat) (pPB-C-His)
PV312182 500 ng
EUR 603

TNMD Protein Vector (Rat) (pPB-N-His)
PV312183 500 ng
EUR 603

TNMD Protein Vector (Rat) (pPM-C-HA)
PV312184 500 ng
EUR 603

TNMD Protein Vector (Rat) (pPM-C-His)
PV312185 500 ng
EUR 603

TNMD Protein Vector (Mouse) (pPB-C-His)
PV240470 500 ng
EUR 603

TNMD Protein Vector (Mouse) (pPB-N-His)
PV240471 500 ng
EUR 603

TNMD Protein Vector (Mouse) (pPM-C-HA)
PV240472 500 ng
EUR 603

TNMD Protein Vector (Mouse) (pPM-C-His)
PV240473 500 ng
EUR 603

Tnmd 3'UTR Luciferase Stable Cell Line
TU120914 1.0 ml Ask for price

Tnmd 3'UTR GFP Stable Cell Line
TU170914 1.0 ml Ask for price

Tnmd 3'UTR Luciferase Stable Cell Line
TU222266 1.0 ml Ask for price

TNMD 3'UTR GFP Stable Cell Line
TU076052 1.0 ml
EUR 1394

TNMD 3'UTR Luciferase Stable Cell Line
TU026052 1.0 ml
EUR 1394

Tnmd 3'UTR GFP Stable Cell Line
TU272266 1.0 ml Ask for price

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

TNMD sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2419005 3 x 1.0 ug
EUR 376

TNMD Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV690205 1.0 ug DNA
EUR 514

TNMD Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV690209 1.0 ug DNA
EUR 514

TNMD Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV690210 1.0 ug DNA
EUR 514

TNMD sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2419006 1.0 ug DNA
EUR 167

TNMD sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2419007 1.0 ug DNA
EUR 167

TNMD sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2419008 1.0 ug DNA
EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6960505 3 x 1.0 ug
EUR 376

Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3684005 3 x 1.0 ug
EUR 376

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

TNMD Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV690206 1.0 ug DNA
EUR 514

TNMD Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV690207 1.0 ug DNA
EUR 572

TNMD Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV690208 1.0 ug DNA
EUR 572

Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6960506 1.0 ug DNA
EUR 167

Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6960507 1.0 ug DNA
EUR 167

Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6960508 1.0 ug DNA
EUR 167

Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3684006 1.0 ug DNA
EUR 167

Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3684007 1.0 ug DNA
EUR 167

Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3684008 1.0 ug DNA
EUR 167

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit
ELA-E0121h 96 Tests
EUR 824

Human KIT/SCFR ELISA kit
LF-EK50791 1×96T
EUR 648

KIT ELISA Kit (Human) (OKAN04574)
OKAN04574 96 Wells
EUR 792
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

KIT ELISA Kit (Human) (OKCD06003)
OKCD06003 96 Wells
EUR 648
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

Human Pentosidine ELISA Kit
201-12-0005 96 tests
EUR 440
  • This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Amylin ELISA Kit
201-12-0017 96 tests
EUR 440
  • This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human visfatin ELISA Kit
201-12-0026 96 tests
EUR 440
  • This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Secretin ELISA Kit
201-12-0027 96 tests
EUR 440
  • This Secretin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human omentin ELISA Kit
201-12-0156 96 tests
EUR 440
  • This omentin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

human Resistin ELISA KIT
201-12-0339 96 tests
EUR 440
  • This Resistin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Collectin ELISA Kit
201-12-0354 96 tests
EUR 440
  • This Collectin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Agrin ELISA Kit
201-12-0414 96 tests
EUR 440
  • This Agrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Thymosin ELISA Kit
201-12-0416 96 tests
EUR 440
  • This Thymosin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human talin ELISA Kit
201-12-0620 96 tests
EUR 440
  • This talin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ponticulin ELISA Kit
201-12-0633 96 tests
EUR 440
  • This ponticulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Slit2 ELISA Kit
201-12-0662 96 tests
EUR 440
  • This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human trypsin ELISA Kit
201-12-0805 96 tests
EUR 440
  • This trypsin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Elastase ELISA Kit
201-12-0812 96 tests
EUR 440
  • This Elastase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ?-glucosidase ELISA Kit
201-12-0854 96 tests
EUR 440
  • This ?-glucosidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ?-lactamase ELISA Kit
201-12-0856 96 tests
EUR 440
  • This ?-lactamase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Methylase ELISA Kit
201-12-0927 96 tests
EUR 440
  • This Methylase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Pancreastatin ELISA Kit
201-12-0984 96 tests
EUR 440
  • This Pancreastatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cortisol ELISA Kit
201-12-1004 96 tests
EUR 440
  • This Cortisol ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Renin ELISA Kit
201-12-1017 96 tests
EUR 440
  • This Renin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human podocin ELISA Kit
201-12-1083 96 tests
EUR 440
  • This podocin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Nephrin ELISA Kit
201-12-1092 96 tests
EUR 440
  • This Nephrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human gelson ELISA Kit
201-12-1204 96 tests
EUR 440
  • This gelson ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Salusin ? ELISA Kit
201-12-1269 96 tests
EUR 440
  • This Salusin alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Salusin-? ELISA Kit
201-12-1273 96 tests
EUR 440
  • This Salusin-? ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human chemerin ELISA Kit
201-12-1436 96 tests
EUR 440
  • This chemerin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human dystrophin ELISA Kit
201-12-1446 96 tests
EUR 440
  • This dystrophin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human preptin ELISA Kit
201-12-1449 96 tests
EUR 440
  • This preptin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human p16 ELISA Kit
201-12-1638 96 tests
EUR 440
  • This p16 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

human colicin ELISA Kit
201-12-1747 96 tests
EUR 440
  • This colicin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Amebiasis ELISA Kit
201-12-1748 96 tests
EUR 440
  • This Amebiasis ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

human schistosoma ELISA Kit
201-12-1749 96 tests
EUR 440
  • This schistosoma ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Enterovirus ELISA Kit
201-12-1809 96 tests
EUR 440
  • This Enterovirus ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human flagellin ELISA Kit
201-12-1815 96 tests
EUR 440
  • This flagellin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cotinine ELISA Kit
201-12-2044 96 tests
EUR 440
  • This Cotinine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Myostatin ELISA Kit
201-12-2092 96 tests
EUR 440
  • This Myostatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Haponin ELISA Kit
201-12-2740 96 tests
EUR 440
  • This Haponin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ANG ELISA Kit
55R-1555 1 kit
EUR 651
Description: ELISA kit for detection of ANG in the research laboratory

Human BDNF ELISA Kit
55R-1556 1 kit
EUR 428
Description: ELISA kit for detection of BDNF in the research laboratory

Human BMP5 ELISA Kit
55R-1559 1 kit
EUR 624
Description: ELISA kit for detection of BMP-5 in the research laboratory

Human BMP2 ELISA Kit
55R-1560 1 kit
EUR 624
Description: ELISA kit for detection of BMP2 in the research laboratory

Human TNMD(Tenomodulin) ELISA Kit