Human TSPO(Translocator Protein) ELISA Kit

Human TSPO(Translocator Protein) ELISA Kit

To Order: Contact us

Human Translocator Protein (TSPO) ELISA Kit

RDR-TSPO-Hu-96Tests 96 Tests
EUR 756

Human Translocator Protein (TSPO) ELISA Kit

RD-TSPO-Hu-48Tests 48 Tests
EUR 521

Human Translocator Protein (TSPO) ELISA Kit

RD-TSPO-Hu-96Tests 96 Tests
EUR 723

Mouse Translocator Protein (TSPO) ELISA Kit

EUR 527
  • Should the Mouse Translocator Protein (TSPO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Translocator Protein (TSPO) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Translocator Protein (TSPO) ELISA Kit

EUR 688
  • Should the Mouse Translocator Protein (TSPO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Translocator Protein (TSPO) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Translocator Protein (TSPO) ELISA Kit

RDR-TSPO-Mu-48Tests 48 Tests
EUR 557

Mouse Translocator Protein (TSPO) ELISA Kit

RDR-TSPO-Mu-96Tests 96 Tests
EUR 774

Mouse Translocator Protein (TSPO) ELISA Kit

RD-TSPO-Mu-48Tests 48 Tests
EUR 533

Mouse Translocator Protein (TSPO) ELISA Kit

RD-TSPO-Mu-96Tests 96 Tests
EUR 740

Human Translocator Protein (TSPO)ELISA Kit

201-12-1458 96 tests
EUR 440
  • This Translocator Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Translocator protein(TSPO) ELISA kit

CSB-EL025168HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Translocator protein (TSPO) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Translocator protein(TSPO) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Translocator protein(TSPO) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Translocator Protein (TSPO) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human TSPO/ Translocator protein ELISA Kit

E2604Hu 1 Kit
EUR 605

Human Translocator protein (TSPO) ELISA Kit

abx572552-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Translocator Protein(TSPO)ELISA Kit

GA-E1474HM-48T 48T
EUR 289

Human Translocator Protein(TSPO)ELISA Kit

GA-E1474HM-96T 96T
EUR 466

Human Translocator protein, TSPO ELISA KIT

ELI-36584h 96 Tests
EUR 824

Human Translocator Protein(TSPO)ELISA Kit

QY-E00088 96T
EUR 394

Human Translocator Protein ELISA Kit (TSPO)

RK02461 96 Tests
EUR 521

Human Translocator Protein (TSPO) ELISA Kit

SEJ628Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Translocator Protein (TSPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Translocator Protein (TSPO) in tissue homogenates, cell lysates and other biological fluids.

Human Translocator Protein (TSPO) ELISA Kit

SEJ628Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Translocator Protein (TSPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Translocator Protein (TSPO) in tissue homogenates, cell lysates and other biological fluids.

Human Translocator Protein (TSPO) ELISA Kit

SEJ628Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Translocator Protein (TSPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Translocator Protein (TSPO) in tissue homogenates, cell lysates and other biological fluids.

Human Translocator Protein (TSPO) ELISA Kit

SEJ628Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Translocator Protein (TSPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Translocator Protein (TSPO) in tissue homogenates, cell lysates and other biological fluids.

Human Translocator Protein (TSPO) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Translocator Protein elisa. Alternative names of the recognized antigen: IBP
  • PKBS
  • PBR
  • pk18
  • mDRC
  • MBR
  • BZRP
  • DBI
  • PTBR
  • Mitochondrial benzodiazepine receptor
  • Peripheral-Type Benzodiazepine Receptor/Recognition Site
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Translocator Protein (TSPO) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Translocator protein(TSPO) ELISA kit

CSB-EL025168RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Translocator protein (TSPO) in samples from serum, plasma, bronchoalveolarlavagefluid, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Translocator protein(TSPO) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Translocator protein(TSPO) in samples from serum, plasma, bronchoalveolarlavagefluid, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Translocator protein (TSPO) ELISA Kit

abx254951-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Tspo/ Translocator protein ELISA Kit

E1014Ra 1 Kit
EUR 646

Mouse Tspo/ Translocator protein ELISA Kit

E1538Mo 1 Kit
EUR 632

Porcine Translocator protein, TSPO ELISA KIT

ELI-17027p 96 Tests
EUR 928

Bovine Translocator protein, TSPO ELISA KIT

ELI-17931b 96 Tests
EUR 928

Mouse Translocator protein, Tspo ELISA KIT

ELI-17932m 96 Tests
EUR 865

Rat Translocator protein, Tspo ELISA KIT

ELI-28400r 96 Tests
EUR 886

Cow Translocator Protein (TSPO) ELISA Kit

abx516773-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pig Translocator Protein (TSPO) ELISA Kit

abx516778-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Translocator protein (TSPO) ELISA Kit

abx516779-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Tspo(Translocator protein) ELISA Kit

EM0600 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: P50637
  • Alias: Tspo/Translocator protein/PBR/Peripheral-type benzodiazepine receptor/Mitochondrial benzodiazepine receptor/PKBS/Bzrp/Mbr
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml

Human Translocator Protein (TSPO) Protein

  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Human TSPO (Translocator Protein)

ELK3592 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Translocator Protein (TSPO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transl
  • Show more
Description: A sandwich ELISA kit for detection of Translocator Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Translocator Protein (TSPO) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Translocator Protein (TSPO) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Translocator Protein (TSPO) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Translocator Protein (TSPO) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Translocator Protein (TSPO) Antibody

abx145873-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Translocator Protein (TSPO) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Translocator Protein (TSPO) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Translocator Protein (TSPO) Antibody

  • EUR 411.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pig Translocator protein (TSPO)

  • EUR 1213.00
  • EUR 487.00
  • EUR 743.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 38.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Pig Translocator protein(TSPO) expressed in in vitro E.coli expression system

Recombinant Translocator Protein (TSPO)

  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P30536
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 48.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Translocator Protein expressed in: E.coli

Recombinant Translocator Protein (TSPO)

  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P30536
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 49.9kDa
  • Isoelectric Point: 9.6
Description: Recombinant Human Translocator Protein expressed in: E.coli

Tspo ELISA Kit| Mouse Translocator protein ELISA Kit

EF013221 96 Tests
EUR 689

Translocator Protein (TSPO) Antibody (HRP)

  • EUR 411.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Translocator Protein (TSPO) Antibody (FITC)

  • EUR 411.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Translocator Protein (TSPO) Antibody (Biotin)

  • EUR 411.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Translocator Protein (TSPO) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSPO (Met1~Glu169)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO)

Translocator Protein (TSPO) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSPO (Met1~Glu169)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO). This antibody is labeled with APC.

Translocator Protein (TSPO) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSPO (Met1~Glu169)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO). This antibody is labeled with Biotin.

Translocator Protein (TSPO) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSPO (Met1~Glu169)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO). This antibody is labeled with Cy3.

Translocator Protein (TSPO) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSPO (Met1~Glu169)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO). This antibody is labeled with FITC.

Translocator Protein (TSPO) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSPO (Met1~Glu169)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO). This antibody is labeled with HRP.

Translocator Protein (TSPO) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSPO (Met1~Glu169)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO). This antibody is labeled with PE.

Translocator Protein (TSPO) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSPO (Met1~Glu169)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO). This antibody is labeled with APC-Cy7.


ELI-23108h 96 Tests
EUR 824

Human Translocator protein ELISA kit

E01T0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Translocator protein ELISA kit

E01T0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Translocator protein ELISA kit

E01T0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TSPO ELISA Kit (Human) (OKAN06395)

OKAN06395 96 Wells
EUR 792
Description: Description of target: Present mainly in the mitochondrial compartment of peripheral tissues, the protein encoded by this gene interacts with some benzodiazepines and has different affinities than its endogenous counterpart. The protein is a key factor in the flow of cholesterol into mitochondria to permit the initiation of steroid hormone synthesis. Alternatively spliced transcript variants have been reported; one of the variants lacks an internal exon and is considered non-coding, and the other variants encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.113 ng/mL

TSPO ELISA Kit (Human) (OKCD02961)

OKCD02961 96 Wells
EUR 831
Description: Description of target: Can bind protoporphyrin IX and may play a role in the transport of porphyrins and heme. Promotes the transport of cholesterol across mitochondrial membranes and may play a role in lipid metabolism, but its precise physiological role is controversial. It is apparently not required for steroid hormone biosynthesis. Was initially identified as peripheral-type benzodiazepine receptor; can also bind isoquinoline carboxamides.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.113 ng/mL

Rabbit Translocator protein ELISA kit

E04T0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Translocator protein ELISA kit

E04T0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Translocator protein ELISA kit

E04T0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Translocator protein ELISA kit

E02T0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Translocator protein ELISA kit

E02T0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Translocator protein ELISA kit

E02T0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Translocator protein ELISA kit

E03T0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Translocator protein ELISA kit

E03T0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Translocator protein ELISA kit

E03T0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Translocator protein ELISA kit

E08T0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Translocator protein ELISA kit

E08T0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Translocator protein ELISA kit

E08T0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Translocator protein ELISA kit

E07T0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Translocator protein ELISA kit

E07T0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Translocator protein ELISA kit

E07T0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Translocator protein ELISA kit

E09T0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Translocator protein ELISA kit

E09T0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Translocator protein ELISA kit

E09T0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Translocator protein ELISA kit

E06T0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Translocator protein ELISA kit

E06T0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Translocator protein ELISA kit

E06T0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TSPO Recombinant Protein (Human)

RP033220 100 ug Ask for price

Human Translocator Protein 2 (TSPO2)ELISA Kit

201-12-2427 96 tests
EUR 440
  • This Translocator Protein 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Translocator protein 2, TSPO2 ELISA KIT

ELI-29066h 96 Tests
EUR 824

Human Translocator Protein 2(TSPO2)ELISA Kit

QY-E00087 96T
EUR 394

TSPO ELISA Kit (Rat) (OKCA02604)

OKCA02604 96 Wells
EUR 846
Description: Description of target: Promotes the transport of cholesterol across mitochondrial membranes and may play a role in lipid metabolism, but its precise physiological role is controversial. It is apparently not required for steroid hormone biosynthesis. Can bind protoporphyrin IX and may play a role in the transport of porphyrins and heme. Was initially identified as peripheral-type benzodiazepine receptor; can also bind isoquinoline carboxamides .;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 15.6 pg/mL

TSPO ELISA Kit (Rat) (OKEH06177)

OKEH06177 96 Wells
EUR 779
Description: Description of target: Promotes the transport of cholesterol across mitochondrial membranes and may play a role in lipid metabolism, but its precise physiological role is controversial. It is apparently not required for steroid hormone biosynthesis. Can bind protoporphyrin IX and may play a role in the transport of porphyrins and heme. Was initially identified as peripheral-type benzodiazepine receptor; can also bind isoquinoline carboxamides.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.16 ng/mL

Tspo ELISA Kit (Mouse) (OKEH04613)

OKEH04613 96 Wells
EUR 779
Description: Description of target: Can bind protoporphyrin IX and may play a role in the transport of porphyrins and heme.. Was initially identified as peripheral-type benzodiazepine receptor; can also bind isoquinoline carboxamides. Promotes the transport of cholesterol across mitochondrial membranes and may play a role in lipid metabolism (PubMed:9832438, PubMed:24814875), but its precise physiological role is controversial. According to some reports, it is not required for steroid hormone biosynthesis (PubMed:24174323, PubMed:24936060).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

Guinea pig Translocator protein ELISA kit

E05T0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Translocator protein ELISA kit

E05T0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Translocator protein ELISA kit

E05T0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Translocator protein

EK3344 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Translocator protein in samples from serum, plasma, tissue homogenates and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

TSPO Antibody

45244-100ul 100ul
EUR 252

TSPO Antibody

45244-50ul 50ul
EUR 187

TSPO Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TSPO. Recognizes TSPO from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

TSPO Antibody

DF8227 200ul
EUR 304
Description: TSPO Antibody detects endogenous levels of total TSPO.

TSPO Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSPO. Recognizes TSPO from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TSPO Antibody

ABD8227 100 ug
EUR 438


PVT18586 2 ug
EUR 231

TSPO Recombinant Protein (Rat)

RP235040 100 ug Ask for price

TSPO Recombinant Protein (Mouse)

RP181838 100 ug Ask for price

Mouse Translocator protein 2, Tspo2 ELISA KIT

ELI-51060m 96 Tests
EUR 865

Rat Translocator Protein 2(TSPO2)ELISA Kit

QY-E10449 96T
EUR 361

Mouse Translocator Protein 2(TSPO2)ELISA Kit

QY-E21510 96T
EUR 361

Human TSPO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ABCB4/ Phosphatidylcholine translocator ABCB4 ELISA Kit

E0010Hu 1 Kit
EUR 605

Human UDP- galactose translocator, SLC35A2 ELISA KIT

ELI-52784h 96 Tests
EUR 824

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

TSPO Rabbit mAb

A10765-100ul 100 ul
EUR 384

TSPO Rabbit mAb

A10765-200ul 200 ul
EUR 554

TSPO Rabbit mAb

A10765-20ul 20 ul Ask for price

TSPO Rabbit mAb

A10765-50ul 50 ul
EUR 265

TSPO Rabbit pAb

A15649-100ul 100 ul
EUR 308

TSPO Rabbit pAb

A15649-200ul 200 ul
EUR 459

TSPO Rabbit pAb

A15649-20ul 20 ul
EUR 183

TSPO Rabbit pAb

A15649-50ul 50 ul
EUR 223

TSPO Blocking Peptide

DF8227-BP 1mg
EUR 195

TSPO Conjugated Antibody

C45244 100ul
EUR 397

TSPO cloning plasmid

CSB-CL025168HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 510
  • Sequence: atggccccgccctgggtgcccgccatgggcttcacgctggcgcccagcctggggtgcttcgtgggctcccgctttgtccacggcgagggtctccgctggtacgccggcctgcagaagccctcgtggcacccgccccactgggtgctgggccctgtctggggcacgctctactcagc
  • Show more
Description: A cloning plasmid for the TSPO gene.

Anti-TSPO antibody

STJ118109 100 µl
EUR 277

Anti-TSPO Antibody

STJ503429 100 µg
EUR 476

Human adenine nucleotide translocator (ANT) autoantibody ELISA kit

E01A1537-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human adenine nucleotide translocator (ANT) autoantibody ELISA kit

E01A1537-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human adenine nucleotide translocator (ANT) autoantibody ELISA kit

E01A1537-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TSPO ORF Vector (Human) (pORF)

ORF011074 1.0 ug DNA
EUR 95

TSPO Protein Vector (Human) (pPB-C-His)

PV044293 500 ng
EUR 329

TSPO Protein Vector (Human) (pPB-N-His)

PV044294 500 ng
EUR 329

TSPO Protein Vector (Human) (pPM-C-HA)

PV044295 500 ng
EUR 329

TSPO Protein Vector (Human) (pPM-C-His)

PV044296 500 ng
EUR 329

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Tspo ELISA Kit| Rat Putative peripheral benzodiazepine receptor

EF019149 96 Tests
EUR 689

TSPO ELISA Kit| Bovine Putative peripheral benzodiazepine recep

EF011733 96 Tests
EUR 689

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Rat Abcb4/ Phosphatidylcholine translocator ABCB4 ELISA Kit

E0007Ra 1 Kit
EUR 646

Bovine UDP- galactose translocator, SLC35A2 ELISA KIT

ELI-29560b 96 Tests
EUR 928

Mouse UDP- galactose translocator, Slc35a2 ELISA KIT

ELI-42036m 96 Tests
EUR 865

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit

EUR 517
  • Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit

EUR 673
  • Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein ELISA Kit (ARNTL)

RK00944 96 Tests
EUR 521

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit

RDR-ARNTL-Hu-48Tests 48 Tests
EUR 544

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit

RDR-ARNTL-Hu-96Tests 96 Tests
EUR 756

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit

SED468Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit

SED468Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit

SED468Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit

SED468Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein elisa. Alternative names of the recognized antigen: BMAL1
  • BMAL1c
  • JAP3
  • MOP3
  • PASD3
  • TIC
  • BHLHE5
  • Basic-helix-loop-helix-PAS protein MOP3
  • Brain and muscle ARNT-like 1
  • Class
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit

RD-ARNTL-Hu-48Tests 48 Tests
EUR 521

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit

RD-ARNTL-Hu-96Tests 96 Tests
EUR 723

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT)ELISA Kit

201-12-2502 96 tests
EUR 440
  • This Aryl Hydrocarbon Receptor Nuclear Translocator ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

EUR 517
  • Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

EUR 673
  • Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aryl hydrocarbon receptor nuclear translocator(ARNT) ELISA kit

E01A1674-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator(ARNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl hydrocarbon receptor nuclear translocator(ARNT) ELISA kit

E01A1674-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator(ARNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl hydrocarbon receptor nuclear translocator(ARNT) ELISA kit

E01A1674-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator(ARNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ARNT/ Aryl hydrocarbon receptor nuclear translocator ELISA Kit

E0204Hu 1 Kit
EUR 571

Human Aryl Hydrocarbon Receptor Nuclear Translocator 2 ELISA kit

E01A0542-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl Hydrocarbon Receptor Nuclear Translocator 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl Hydrocarbon Receptor Nuclear Translocator 2 ELISA kit

E01A0542-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl Hydrocarbon Receptor Nuclear Translocator 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl Hydrocarbon Receptor Nuclear Translocator 2 ELISA kit

E01A0542-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl Hydrocarbon Receptor Nuclear Translocator 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ARNT(Aryl hydrocarbon receptor nuclear translocator) ELISA Kit

EH2202 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P27540
  • Alias: ARNT/Hypoxia-inducible factor 1-beta(HIF-1-beta/HIF1-beta)/Class E basic helix-loop-helix protein 2(bHLHe2)/Dioxin receptor, nuclear translocator/HIF-1 beta/TANGO/ARNT protein/aryl hydrocarbon
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

ELISA kit for Human Aryl hydrocarbon receptor nuclear translocator

EK4476 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Aryl hydrocarbon receptor nuclear translocator in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Aryl hydrocarbon receptor nuclear translocator(ARNT) ELISA kit

CSB-EL002121HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Aryl hydrocarbon receptor nuclear translocator (ARNT) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Aryl hydrocarbon receptor nuclear translocator(ARNT) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Aryl hydrocarbon receptor nuclear translocator(ARNT) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Aryl Hydrocarbon Receptor Nuclear Translocator(ARNT)ELISA Kit

QY-E03636 96T
EUR 374

Human Aryl Hydrocarbon Receptor Nuclear Translocator ELISA Kit (ARNT)

RK00943 96 Tests
EUR 521

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

RDR-ARNT-Hu-48Tests 48 Tests
EUR 544

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

RDR-ARNT-Hu-96Tests 96 Tests
EUR 756

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

SED470Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

SED470Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

SED470Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

SED470Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Aryl Hydrocarbon Receptor Nuclear Translocator elisa. Alternative names of the recognized antigen: HIF-1beta
  • bHLHe2
  • Hypoxia Inducible Factor 1 Beta
  • Class E basic helix-loop-helix protein 2
  • Dioxin receptor, nuclear translocator
  • Hypo
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

RD-ARNT-Hu-48Tests 48 Tests
EUR 521

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit

RD-ARNT-Hu-96Tests 96 Tests
EUR 723

TSPO Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSPO. Recognizes TSPO from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TSPO Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSPO. Recognizes TSPO from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TSPO Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSPO. Recognizes TSPO from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat TSPO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TSPO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-TSPO Antibody (Biotin)

STJ503430 100 µg
EUR 586

Anti-TSPO Antibody (FITC)

STJ503431 100 µg
EUR 586

TSPO sgRNA CRISPR Lentivector set (Human)

K2543301 3 x 1.0 ug
EUR 339

Human Aryl hydrocarbon receptor nuclear translocator like protein 1(ARNTL) ELISA kit

E01A1675-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator like protein 1(ARNTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl hydrocarbon receptor nuclear translocator like protein 1(ARNTL) ELISA kit

E01A1675-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator like protein 1(ARNTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl hydrocarbon receptor nuclear translocator like protein 1(ARNTL) ELISA kit

E01A1675-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator like protein 1(ARNTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl hydrocarbon receptor nuclear translocator like protein 2(ARNTL2) ELISA kit

E01A1676-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator like protein 2(ARNTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl hydrocarbon receptor nuclear translocator like protein 2(ARNTL2) ELISA kit

E01A1676-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator like protein 2(ARNTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl hydrocarbon receptor nuclear translocator like protein 2(ARNTL2) ELISA kit

E01A1676-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator like protein 2(ARNTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ARNTL(Aryl hydrocarbon receptor nuclear translocator-like protein 1) ELISA Kit

EH6460 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

ELISA kit for Human ARNTL (Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein)

ELK5308 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL). Standards or samples are then added to the appropriate microtiter plate wells with a bioti
  • Show more
Description: A sandwich ELISA kit for detection of Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Rat adenine nucleotide translocator (ANT) autoantibody ELISA kit

E02A1537-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat adenine nucleotide translocator (ANT) autoantibody ELISA kit

E02A1537-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat adenine nucleotide translocator (ANT) autoantibody ELISA kit

E02A1537-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat adenine nucleotide translocator (ANT) autoantibody ELISA kit

E06A1537-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat adenine nucleotide translocator (ANT) autoantibody ELISA kit

E06A1537-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat adenine nucleotide translocator (ANT) autoantibody ELISA kit

E06A1537-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse adenine nucleotide translocator (ANT) autoantibody ELISA kit

E03A1537-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse adenine nucleotide translocator (ANT) autoantibody ELISA kit

E03A1537-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse adenine nucleotide translocator (ANT) autoantibody ELISA kit

E03A1537-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit adenine nucleotide translocator (ANT) autoantibody ELISA kit

E04A1537-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit adenine nucleotide translocator (ANT) autoantibody ELISA kit

E04A1537-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit adenine nucleotide translocator (ANT) autoantibody ELISA kit

E04A1537-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig adenine nucleotide translocator (ANT) autoantibody ELISA kit

E07A1537-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig adenine nucleotide translocator (ANT) autoantibody ELISA kit

E07A1537-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig adenine nucleotide translocator (ANT) autoantibody ELISA kit

E07A1537-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog adenine nucleotide translocator (ANT) autoantibody ELISA kit

E08A1537-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog adenine nucleotide translocator (ANT) autoantibody ELISA kit

E08A1537-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog adenine nucleotide translocator (ANT) autoantibody ELISA kit

E08A1537-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey adenine nucleotide translocator (ANT) autoantibody ELISA kit

E09A1537-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey adenine nucleotide translocator (ANT) autoantibody ELISA kit

E09A1537-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human TSPO(Translocator Protein) ELISA Kit