Human TSPO(Translocator Protein) ELISA Kit

Human TSPO(Translocator Protein) ELISA Kit

To Order: Contact us

Human Translocator Protein (TSPO) ELISA Kit
RDR-TSPO-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Translocator Protein (TSPO) ELISA Kit
RD-TSPO-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Translocator Protein (TSPO) ELISA Kit
RD-TSPO-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Translocator Protein (TSPO) ELISA Kit
DLR-TSPO-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Translocator Protein (TSPO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Translocator Protein (TSPO) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Translocator Protein (TSPO) ELISA Kit
DLR-TSPO-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Translocator Protein (TSPO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Translocator Protein (TSPO) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Translocator Protein (TSPO) ELISA Kit
RDR-TSPO-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Translocator Protein (TSPO) ELISA Kit
RDR-TSPO-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Translocator Protein (TSPO) ELISA Kit
RD-TSPO-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Translocator Protein (TSPO) ELISA Kit
RD-TSPO-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Translocator Protein (TSPO)ELISA Kit
201-12-1458	SunredBio	96 tests	EUR 440
This Translocator Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Translocator protein(TSPO) ELISA kit
CSB-EL025168HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Translocator protein (TSPO) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Translocator protein(TSPO) ELISA kit
1-CSB-EL025168HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Translocator protein(TSPO) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Translocator Protein (TSPO) ELISA Kit
20-abx153381	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human TSPO/ Translocator protein ELISA Kit
E2604Hu	Sunlong	1 Kit	EUR 605

Human Translocator protein (TSPO) ELISA Kit
abx572552-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Translocator Protein(TSPO)ELISA Kit
GA-E1474HM-48T	GenAsia Biotech	48T	EUR 289

Human Translocator Protein(TSPO)ELISA Kit
GA-E1474HM-96T	GenAsia Biotech	96T	EUR 466

Human Translocator protein, TSPO ELISA KIT
ELI-36584h	Lifescience Market	96 Tests	EUR 824

Human Translocator Protein(TSPO)ELISA Kit
QY-E00088	Qayee Biotechnology	96T	EUR 394

Human Translocator Protein ELISA Kit (TSPO)
RK02461	Abclonal	96 Tests	EUR 521

Human Translocator Protein (TSPO) ELISA Kit
SEJ628Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Translocator Protein (TSPO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Translocator Protein (TSPO) in tissue homogenates, cell lysates and other biological fluids.

Human Translocator Protein (TSPO) ELISA Kit
SEJ628Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Translocator Protein (TSPO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Translocator Protein (TSPO) in tissue homogenates, cell lysates and other biological fluids.

Human Translocator Protein (TSPO) ELISA Kit
SEJ628Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Translocator Protein (TSPO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Translocator Protein (TSPO) in tissue homogenates, cell lysates and other biological fluids.

Human Translocator Protein (TSPO) ELISA Kit
SEJ628Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Translocator Protein (TSPO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Translocator Protein (TSPO) in tissue homogenates, cell lysates and other biological fluids.

Human Translocator Protein (TSPO) ELISA Kit
4-SEJ628Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Translocator Protein elisa. Alternative names of the recognized antigen: IBP PKBS PBR pk18 mDRC MBR BZRP DBI PTBR Mitochondrial benzodiazepine receptor Peripheral-Type Benzodiazepine Receptor/Recognition Site
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Translocator Protein (TSPO) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Translocator protein(TSPO) ELISA kit
CSB-EL025168RA-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Translocator protein (TSPO) in samples from serum, plasma, bronchoalveolarlavagefluid, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Translocator protein(TSPO) ELISA kit
1-CSB-EL025168RA	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Translocator protein(TSPO) in samples from serum, plasma, bronchoalveolarlavagefluid, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Translocator protein (TSPO) ELISA Kit
abx254951-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Tspo/ Translocator protein ELISA Kit
E1014Ra	Sunlong	1 Kit	EUR 646

Mouse Tspo/ Translocator protein ELISA Kit
E1538Mo	Sunlong	1 Kit	EUR 632

Porcine Translocator protein, TSPO ELISA KIT
ELI-17027p	Lifescience Market	96 Tests	EUR 928

Bovine Translocator protein, TSPO ELISA KIT
ELI-17931b	Lifescience Market	96 Tests	EUR 928

Mouse Translocator protein, Tspo ELISA KIT
ELI-17932m	Lifescience Market	96 Tests	EUR 865

Rat Translocator protein, Tspo ELISA KIT
ELI-28400r	Lifescience Market	96 Tests	EUR 886

Cow Translocator Protein (TSPO) ELISA Kit
abx516773-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Pig Translocator Protein (TSPO) ELISA Kit
abx516778-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Translocator protein (TSPO) ELISA Kit
abx516779-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Mouse Tspo(Translocator protein) ELISA Kit
EM0600	FN Test	96T	EUR 567.6
Detection range: 0.78-50 ng/ml Uniprot ID: P50637 Alias: Tspo/Translocator protein/PBR/Peripheral-type benzodiazepine receptor/Mitochondrial benzodiazepine receptor/PKBS/Bzrp/Mbr
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml

Human Translocator Protein (TSPO) Protein
20-abx165906	Abbexa	EUR 676.00 EUR 272.00 EUR 2068.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Human TSPO (Translocator Protein)
ELK3592	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Translocator Protein (TSPO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transl Show more
Description: A sandwich ELISA kit for detection of Translocator Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Translocator Protein (TSPO) CLIA Kit
20-abx495750	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Translocator Protein (TSPO) Antibody
20-abx219161	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Translocator Protein (TSPO) Antibody
20-abx125401	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Translocator Protein (TSPO) Antibody
20-abx128224	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Translocator Protein (TSPO) Antibody
abx145873-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Translocator Protein (TSPO) Antibody
20-abx174912	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Translocator Protein (TSPO) Antibody
20-abx323874	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Translocator Protein (TSPO) Antibody
20-abx334091	Abbexa	EUR 411.00 EUR 182.00 EUR 300.00	100 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pig Translocator protein (TSPO)
1-CSB-CF764926PI	Cusabio	EUR 1213.00 EUR 487.00 EUR 743.00	1MG 200ug 500ug
MW: 38.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Pig Translocator protein(TSPO) expressed in in vitro E.coli expression system

Recombinant Translocator Protein (TSPO)
4-RPJ628Hu01	Cloud-Clone	EUR 483.49 EUR 232.00 EUR 1538.08 EUR 579.36 EUR 1058.72 EUR 386.00 EUR 3695.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P30536 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 48.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Translocator Protein expressed in: E.coli

Recombinant Translocator Protein (TSPO)
4-RPJ628Hu02	Cloud-Clone	EUR 483.49 EUR 232.00 EUR 1538.08 EUR 579.36 EUR 1058.72 EUR 386.00 EUR 3695.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P30536 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 49.9kDa Isoelectric Point: 9.6
Description: Recombinant Human Translocator Protein expressed in: E.coli

Tspo ELISA Kit| Mouse Translocator protein ELISA Kit
EF013221	Lifescience Market	96 Tests	EUR 689

Translocator Protein (TSPO) Antibody (HRP)
20-abx337381	Abbexa	EUR 411.00 EUR 182.00 EUR 300.00	100 ug 20 ug 50 ug
Shipped within 5-10 working days.

Translocator Protein (TSPO) Antibody (FITC)
20-abx337382	Abbexa	EUR 411.00 EUR 182.00 EUR 300.00	100 ug 20 ug 50 ug
Shipped within 5-10 working days.

Translocator Protein (TSPO) Antibody (Biotin)
20-abx337383	Abbexa	EUR 411.00 EUR 182.00 EUR 300.00	100 ug 20 ug 50 ug
Shipped within 5-10 working days.

Translocator Protein (TSPO) Polyclonal Antibody (Human)
4-PAJ628Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSPO (Met1~Glu169) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO)

Translocator Protein (TSPO) Polyclonal Antibody (Human), APC
4-PAJ628Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSPO (Met1~Glu169) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO). This antibody is labeled with APC.

Translocator Protein (TSPO) Polyclonal Antibody (Human), Biotinylated
4-PAJ628Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSPO (Met1~Glu169) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO). This antibody is labeled with Biotin.

Translocator Protein (TSPO) Polyclonal Antibody (Human), Cy3
4-PAJ628Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSPO (Met1~Glu169) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO). This antibody is labeled with Cy3.

Translocator Protein (TSPO) Polyclonal Antibody (Human), FITC
4-PAJ628Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSPO (Met1~Glu169) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO). This antibody is labeled with FITC.

Translocator Protein (TSPO) Polyclonal Antibody (Human), HRP
4-PAJ628Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSPO (Met1~Glu169) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO). This antibody is labeled with HRP.

Translocator Protein (TSPO) Polyclonal Antibody (Human), PE
4-PAJ628Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSPO (Met1~Glu169) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO). This antibody is labeled with PE.

Translocator Protein (TSPO) Polyclonal Antibody (Human), APC-Cy7
4-PAJ628Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSPO (Met1~Glu169) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Translocator Protein (TSPO). This antibody is labeled with APC-Cy7.

Human TSPO ELISA KIT
ELI-23108h	Lifescience Market	96 Tests	EUR 824

Human Translocator protein ELISA kit
E01T0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Translocator protein ELISA kit
E01T0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Translocator protein ELISA kit
E01T0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TSPO ELISA Kit (Human) (OKAN06395)
OKAN06395	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Present mainly in the mitochondrial compartment of peripheral tissues, the protein encoded by this gene interacts with some benzodiazepines and has different affinities than its endogenous counterpart. The protein is a key factor in the flow of cholesterol into mitochondria to permit the initiation of steroid hormone synthesis. Alternatively spliced transcript variants have been reported; one of the variants lacks an internal exon and is considered non-coding, and the other variants encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.113 ng/mL

TSPO ELISA Kit (Human) (OKCD02961)
OKCD02961	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Can bind protoporphyrin IX and may play a role in the transport of porphyrins and heme. Promotes the transport of cholesterol across mitochondrial membranes and may play a role in lipid metabolism, but its precise physiological role is controversial. It is apparently not required for steroid hormone biosynthesis. Was initially identified as peripheral-type benzodiazepine receptor; can also bind isoquinoline carboxamides.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.113 ng/mL

Rabbit Translocator protein ELISA kit
E04T0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Translocator protein ELISA kit
E04T0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Translocator protein ELISA kit
E04T0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Translocator protein ELISA kit
E02T0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Translocator protein ELISA kit
E02T0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Translocator protein ELISA kit
E02T0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Translocator protein ELISA kit
E03T0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Translocator protein ELISA kit
E03T0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Translocator protein ELISA kit
E03T0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Translocator protein ELISA kit
E08T0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Translocator protein ELISA kit
E08T0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Translocator protein ELISA kit
E08T0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Translocator protein ELISA kit
E07T0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Translocator protein ELISA kit
E07T0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Translocator protein ELISA kit
E07T0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Translocator protein ELISA kit
E09T0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Translocator protein ELISA kit
E09T0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Translocator protein ELISA kit
E09T0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Translocator protein ELISA kit
E06T0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Translocator protein ELISA kit
E06T0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Translocator protein ELISA kit
E06T0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TSPO Recombinant Protein (Human)
RP033220	ABM	100 ug	Ask for price

Human Translocator Protein 2 (TSPO2)ELISA Kit
201-12-2427	SunredBio	96 tests	EUR 440
This Translocator Protein 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Translocator protein 2, TSPO2 ELISA KIT
ELI-29066h	Lifescience Market	96 Tests	EUR 824

Human Translocator Protein 2(TSPO2)ELISA Kit
QY-E00087	Qayee Biotechnology	96T	EUR 394

TSPO ELISA Kit (Rat) (OKCA02604)
OKCA02604	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Promotes the transport of cholesterol across mitochondrial membranes and may play a role in lipid metabolism, but its precise physiological role is controversial. It is apparently not required for steroid hormone biosynthesis. Can bind protoporphyrin IX and may play a role in the transport of porphyrins and heme. Was initially identified as peripheral-type benzodiazepine receptor; can also bind isoquinoline carboxamides .;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 15.6 pg/mL

TSPO ELISA Kit (Rat) (OKEH06177)
OKEH06177	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Promotes the transport of cholesterol across mitochondrial membranes and may play a role in lipid metabolism, but its precise physiological role is controversial. It is apparently not required for steroid hormone biosynthesis. Can bind protoporphyrin IX and may play a role in the transport of porphyrins and heme. Was initially identified as peripheral-type benzodiazepine receptor; can also bind isoquinoline carboxamides.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.16 ng/mL

Tspo ELISA Kit (Mouse) (OKEH04613)
OKEH04613	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Can bind protoporphyrin IX and may play a role in the transport of porphyrins and heme.. Was initially identified as peripheral-type benzodiazepine receptor; can also bind isoquinoline carboxamides. Promotes the transport of cholesterol across mitochondrial membranes and may play a role in lipid metabolism (PubMed:9832438, PubMed:24814875), but its precise physiological role is controversial. According to some reports, it is not required for steroid hormone biosynthesis (PubMed:24174323, PubMed:24936060).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

Guinea pig Translocator protein ELISA kit
E05T0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Translocator protein ELISA kit
E05T0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Translocator protein ELISA kit
E05T0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Translocator protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Translocator protein
EK3344	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Translocator protein in samples from serum, plasma, tissue homogenates and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

TSPO Antibody
45244-100ul	SAB	100ul	EUR 252

TSPO Antibody
45244-50ul	SAB	50ul	EUR 187

TSPO Antibody
1-CSB-PA050257	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TSPO. Recognizes TSPO from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

TSPO Antibody
DF8227	Affbiotech	200ul	EUR 304
Description: TSPO Antibody detects endogenous levels of total TSPO.

TSPO Antibody
1-CSB-PA536576LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSPO. Recognizes TSPO from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TSPO siRNA
20-abx905841	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TSPO siRNA
20-abx938360	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TSPO siRNA
20-abx938361	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TSPO Antibody
ABD8227	Lifescience Market	100 ug	EUR 438

pOTB7-TSPO
PVT18586	Lifescience Market	2 ug	EUR 231

TSPO Recombinant Protein (Rat)
RP235040	ABM	100 ug	Ask for price

TSPO Recombinant Protein (Mouse)
RP181838	ABM	100 ug	Ask for price

Mouse Translocator protein 2, Tspo2 ELISA KIT
ELI-51060m	Lifescience Market	96 Tests	EUR 865

Rat Translocator Protein 2(TSPO2)ELISA Kit
QY-E10449	Qayee Biotechnology	96T	EUR 361

Mouse Translocator Protein 2(TSPO2)ELISA Kit
QY-E21510	Qayee Biotechnology	96T	EUR 361

Human TSPO shRNA Plasmid
20-abx950488	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ABCB4/ Phosphatidylcholine translocator ABCB4 ELISA Kit
E0010Hu	Sunlong	1 Kit	EUR 605

Human UDP- galactose translocator, SLC35A2 ELISA KIT
ELI-52784h	Lifescience Market	96 Tests	EUR 824

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

TSPO Rabbit mAb
A10765-100ul	Abclonal	100 ul	EUR 384

TSPO Rabbit mAb
A10765-200ul	Abclonal	200 ul	EUR 554

TSPO Rabbit mAb
A10765-20ul	Abclonal	20 ul	Ask for price

TSPO Rabbit mAb
A10765-50ul	Abclonal	50 ul	EUR 265

TSPO Rabbit pAb
A15649-100ul	Abclonal	100 ul	EUR 308

TSPO Rabbit pAb
A15649-200ul	Abclonal	200 ul	EUR 459

TSPO Rabbit pAb
A15649-20ul	Abclonal	20 ul	EUR 183

TSPO Rabbit pAb
A15649-50ul	Abclonal	50 ul	EUR 223

TSPO Blocking Peptide
DF8227-BP	Affbiotech	1mg	EUR 195

TSPO Conjugated Antibody
C45244	SAB	100ul	EUR 397

TSPO cloning plasmid
CSB-CL025168HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 510 Sequence: atggccccgccctgggtgcccgccatgggcttcacgctggcgcccagcctggggtgcttcgtgggctcccgctttgtccacggcgagggtctccgctggtacgccggcctgcagaagccctcgtggcacccgccccactgggtgctgggccctgtctggggcacgctctactcagc Show more
Description: A cloning plasmid for the TSPO gene.

Anti-TSPO antibody
STJ118109	St John's Laboratory	100 µl	EUR 277

Anti-TSPO Antibody
STJ503429	St John's Laboratory	100 µg	EUR 476

Human adenine nucleotide translocator (ANT) autoantibody ELISA kit
E01A1537-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human adenine nucleotide translocator (ANT) autoantibody ELISA kit
E01A1537-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human adenine nucleotide translocator (ANT) autoantibody ELISA kit
E01A1537-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TSPO ORF Vector (Human) (pORF)
ORF011074	ABM	1.0 ug DNA	EUR 95

TSPO Protein Vector (Human) (pPB-C-His)
PV044293	ABM	500 ng	EUR 329

TSPO Protein Vector (Human) (pPB-N-His)
PV044294	ABM	500 ng	EUR 329

TSPO Protein Vector (Human) (pPM-C-HA)
PV044295	ABM	500 ng	EUR 329

TSPO Protein Vector (Human) (pPM-C-His)
PV044296	ABM	500 ng	EUR 329

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Tspo ELISA Kit| Rat Putative peripheral benzodiazepine receptor
EF019149	Lifescience Market	96 Tests	EUR 689

TSPO ELISA Kit| Bovine Putative peripheral benzodiazepine recep
EF011733	Lifescience Market	96 Tests	EUR 689

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Rat Abcb4/ Phosphatidylcholine translocator ABCB4 ELISA Kit
E0007Ra	Sunlong	1 Kit	EUR 646

Bovine UDP- galactose translocator, SLC35A2 ELISA KIT
ELI-29560b	Lifescience Market	96 Tests	EUR 928

Mouse UDP- galactose translocator, Slc35a2 ELISA KIT
ELI-42036m	Lifescience Market	96 Tests	EUR 865

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit
DLR-ARNTL-Hu-48T	DL Develop	48T	EUR 517
Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit
DLR-ARNTL-Hu-96T	DL Develop	96T	EUR 673
Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit
20-abx258558	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit
20-abx585344	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein ELISA Kit (ARNTL)
RK00944	Abclonal	96 Tests	EUR 521

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit
RDR-ARNTL-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit
RDR-ARNTL-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit
SED468Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit
SED468Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit
SED468Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit
SED468Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit
4-SED468Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein elisa. Alternative names of the recognized antigen: BMAL1 BMAL1c JAP3 MOP3 PASD3 TIC BHLHE5 Basic-helix-loop-helix-PAS protein MOP3 Brain and muscle ARNT-like 1 Class Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit
RD-ARNTL-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL) ELISA Kit
RD-ARNTL-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT)ELISA Kit
201-12-2502	SunredBio	96 tests	EUR 440
This Aryl Hydrocarbon Receptor Nuclear Translocator ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
DLR-ARNT-Hu-48T	DL Develop	48T	EUR 517
Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
DLR-ARNT-Hu-96T	DL Develop	96T	EUR 673
Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aryl hydrocarbon receptor nuclear translocator(ARNT) ELISA kit
E01A1674-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator(ARNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl hydrocarbon receptor nuclear translocator(ARNT) ELISA kit
E01A1674-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator(ARNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl hydrocarbon receptor nuclear translocator(ARNT) ELISA kit
E01A1674-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator(ARNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ARNT/ Aryl hydrocarbon receptor nuclear translocator ELISA Kit
E0204Hu	Sunlong	1 Kit	EUR 571

Human Aryl Hydrocarbon Receptor Nuclear Translocator 2 ELISA kit
E01A0542-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl Hydrocarbon Receptor Nuclear Translocator 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl Hydrocarbon Receptor Nuclear Translocator 2 ELISA kit
E01A0542-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl Hydrocarbon Receptor Nuclear Translocator 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl Hydrocarbon Receptor Nuclear Translocator 2 ELISA kit
E01A0542-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl Hydrocarbon Receptor Nuclear Translocator 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ARNT(Aryl hydrocarbon receptor nuclear translocator) ELISA Kit
EH2202	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P27540 Alias: ARNT/Hypoxia-inducible factor 1-beta(HIF-1-beta/HIF1-beta)/Class E basic helix-loop-helix protein 2(bHLHe2)/Dioxin receptor, nuclear translocator/HIF-1 beta/TANGO/ARNT protein/aryl hydrocarbon Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

ELISA kit for Human Aryl hydrocarbon receptor nuclear translocator
EK4476	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Aryl hydrocarbon receptor nuclear translocator in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Aryl hydrocarbon receptor nuclear translocator(ARNT) ELISA kit
CSB-EL002121HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Aryl hydrocarbon receptor nuclear translocator (ARNT) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Aryl hydrocarbon receptor nuclear translocator(ARNT) ELISA kit
1-CSB-EL002121HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Aryl hydrocarbon receptor nuclear translocator(ARNT) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Aryl Hydrocarbon Receptor Nuclear Translocator(ARNT)ELISA Kit
QY-E03636	Qayee Biotechnology	96T	EUR 374

Human Aryl Hydrocarbon Receptor Nuclear Translocator ELISA Kit (ARNT)
RK00943	Abclonal	96 Tests	EUR 521

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RDR-ARNT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RDR-ARNT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
SED470Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
SED470Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
SED470Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
SED470Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in tissue homogenates, cell lysates and other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
4-SED470Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Aryl Hydrocarbon Receptor Nuclear Translocator elisa. Alternative names of the recognized antigen: HIF-1beta bHLHe2 Hypoxia Inducible Factor 1 Beta Class E basic helix-loop-helix protein 2 Dioxin receptor, nuclear translocator Hypo Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RD-ARNT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RD-ARNT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

TSPO Antibody, HRP conjugated
1-CSB-PA536576LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSPO. Recognizes TSPO from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TSPO Antibody, FITC conjugated
1-CSB-PA536576LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSPO. Recognizes TSPO from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TSPO Antibody, Biotin conjugated
1-CSB-PA536576LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSPO. Recognizes TSPO from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat TSPO shRNA Plasmid
20-abx984390	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TSPO shRNA Plasmid
20-abx969407	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-TSPO Antibody (Biotin)
STJ503430	St John's Laboratory	100 µg	EUR 586

Anti-TSPO Antibody (FITC)
STJ503431	St John's Laboratory	100 µg	EUR 586

TSPO sgRNA CRISPR Lentivector set (Human)
K2543301	ABM	3 x 1.0 ug	EUR 339

Human Aryl hydrocarbon receptor nuclear translocator like protein 1(ARNTL) ELISA kit
E01A1675-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator like protein 1(ARNTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl hydrocarbon receptor nuclear translocator like protein 1(ARNTL) ELISA kit
E01A1675-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator like protein 1(ARNTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl hydrocarbon receptor nuclear translocator like protein 1(ARNTL) ELISA kit
E01A1675-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator like protein 1(ARNTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl hydrocarbon receptor nuclear translocator like protein 2(ARNTL2) ELISA kit
E01A1676-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator like protein 2(ARNTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl hydrocarbon receptor nuclear translocator like protein 2(ARNTL2) ELISA kit
E01A1676-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator like protein 2(ARNTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aryl hydrocarbon receptor nuclear translocator like protein 2(ARNTL2) ELISA kit
E01A1676-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aryl hydrocarbon receptor nuclear translocator like protein 2(ARNTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ARNTL(Aryl hydrocarbon receptor nuclear translocator-like protein 1) ELISA Kit
EH6460	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

ELISA kit for Human ARNTL (Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein)
ELK5308	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein (ARNTL). Standards or samples are then added to the appropriate microtiter plate wells with a bioti Show more
Description: A sandwich ELISA kit for detection of Aryl Hydrocarbon Receptor Nuclear Translocator Like Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Rat adenine nucleotide translocator (ANT) autoantibody ELISA kit
E02A1537-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat adenine nucleotide translocator (ANT) autoantibody ELISA kit
E02A1537-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat adenine nucleotide translocator (ANT) autoantibody ELISA kit
E02A1537-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat adenine nucleotide translocator (ANT) autoantibody ELISA kit
E06A1537-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat adenine nucleotide translocator (ANT) autoantibody ELISA kit
E06A1537-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat adenine nucleotide translocator (ANT) autoantibody ELISA kit
E06A1537-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse adenine nucleotide translocator (ANT) autoantibody ELISA kit
E03A1537-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse adenine nucleotide translocator (ANT) autoantibody ELISA kit
E03A1537-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse adenine nucleotide translocator (ANT) autoantibody ELISA kit
E03A1537-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit adenine nucleotide translocator (ANT) autoantibody ELISA kit
E04A1537-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit adenine nucleotide translocator (ANT) autoantibody ELISA kit
E04A1537-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit adenine nucleotide translocator (ANT) autoantibody ELISA kit
E04A1537-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig adenine nucleotide translocator (ANT) autoantibody ELISA kit
E07A1537-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig adenine nucleotide translocator (ANT) autoantibody ELISA kit
E07A1537-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig adenine nucleotide translocator (ANT) autoantibody ELISA kit
E07A1537-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog adenine nucleotide translocator (ANT) autoantibody ELISA kit
E08A1537-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog adenine nucleotide translocator (ANT) autoantibody ELISA kit
E08A1537-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog adenine nucleotide translocator (ANT) autoantibody ELISA kit
E08A1537-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey adenine nucleotide translocator (ANT) autoantibody ELISA kit
E09A1537-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey adenine nucleotide translocator (ANT) autoantibody ELISA kit
E09A1537-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey adenine nucleotide translocator (ANT) autoantibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human TSPO(Translocator Protein) ELISA Kit