Human TWSG1(Twisted Gastrulation Protein Homolog 1) ELISA Kit

Human TWSG1(Twisted Gastrulation Protein Homolog 1) ELISA Kit

To Order: Contact us

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit

RDR-TWSG1-Hu-48Tests 48 Tests
EUR 544

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit

RDR-TWSG1-Hu-96Tests 96 Tests
EUR 756

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit

RD-TWSG1-Hu-48Tests 48 Tests
EUR 521

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit

RD-TWSG1-Hu-96Tests 96 Tests
EUR 723

Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody

20-abx128102
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody

20-abx174995
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody

abx239120-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Twisted Gastrulation Protein Homolog 1 (TWSG1)

4-RPF862Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9GZX9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Twisted Gastrulation Protein Homolog 1 expressed in: E.coli

Human Twisted Gastrulation Protein Homolog 1 (TWSG1)ELISA Kit

201-12-2425 96 tests
EUR 440
  • This Twisted Gastrulation Protein Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

CSB-EL025361HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

1-CSB-EL025361HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Twisted gastrulation protein homolog 1(TWSG1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E01T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E01T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E01T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit

20-abx153413
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Twisted gastrulation protein homolog 1, TWSG1 ELISA KIT

ELI-28284h 96 Tests
EUR 824

Human Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit

QY-E02014 96T
EUR 361

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit

SEF862Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids.

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit

SEF862Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids.

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit

SEF862Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids.

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit

SEF862Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids.

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit

4-SEF862Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Twisted Gastrulation Protein Homolog 1 elisa. Alternative names of the recognized antigen: TSG
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) Protein

20-abx166022
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

CSB-EL025361MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Twisted gastrulation protein homolog 1 (TWSG1) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

1-CSB-EL025361MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E02T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E02T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E02T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E04T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E04T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E04T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E03T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E03T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E03T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E08T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E08T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E08T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E07T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E07T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E07T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E09T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E09T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E09T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E06T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E06T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E06T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Twisted gastrulation protein homolog 1, Twsg1 ELISA KIT

ELI-23125m 96 Tests
EUR 865

Chicken Twisted gastrulation protein homolog 1, TWSG1 ELISA KIT

ELI-44811c 96 Tests
EUR 928

Rat Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit

QY-E10438 96T
EUR 361

Mouse Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit

QY-E21552 96T
EUR 361

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) CLIA Kit

20-abx495028
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human TWSG1 (Twisted Gastrulation Protein Homolog 1)

ELK3568 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Twisted Gastrulation Protein Homolog 1 (TWSG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody
  • Show more
Description: A sandwich ELISA kit for detection of Twisted Gastrulation Protein Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1)

KTE60114-48T 48T
EUR 332
  • The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1)

KTE60114-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1)

KTE60114-96T 96T
EUR 539
  • The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human)

4-PAF862Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1)

Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E05T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E05T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit

E05T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), APC

4-PAF862Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with APC.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), Biotinylated

4-PAF862Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with Biotin.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), Cy3

4-PAF862Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with Cy3.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), FITC

4-PAF862Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with FITC.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), HRP

4-PAF862Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with HRP.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), PE

4-PAF862Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with PE.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), APC-Cy7

4-PAF862Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with APC-Cy7.

Twisted Gastrulation, His, Human

HY-P7418 10ug
EUR 176

TSG Twisted Gastrulation Protein Human Recombinant Protein

PROTQ9GZX9 Regular: 50ug
EUR 317
Description: TWSG1 Human Recombinant (26-223) produced in CHO is a single, glycosylated, polypeptide chain containing 198 amino acids and having a molecular mass ranging from 35-43kDa on SDS-PAGE due to glycosylation.;The TWSG1 is purified by proprietary chromatographic techniques.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

TWSG1 ELISA KIT|Human

EF003957 96 Tests
EUR 689

TWSG1 ELISA Kit (Human) (OKCD00986)

OKCD00986 96 Wells
EUR 831
Description: Description of target: May be involved in dorsoventral axis formation. Seems to antagonize BMP signaling by forming ternary complexes with CHRD and BMPs, thereby preventing BMPs from binding to their receptors. In addition to the anti-BMP function, also has pro-BMP activity, partly mediated by cleavage and degradation of CHRD, which releases BMPs from ternary complexes. May be an important modulator of BMP-regulated cartilage development and chondrocyte differentiation. May play a role in thymocyte development (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.122 ng/mL

Recombinant Human TWSG1 Protein

RP01049 10 μg
EUR 155

TWSG1 Recombinant Protein (Human)

RP033538 100 ug Ask for price

TWSG1 ELISA Kit (Mouse) (OKCA00932)

OKCA00932 96 Wells
EUR 833
Description: Description of target: May be involved in dorsoventral axis formation. Seems to antagonize BMP signaling by forming ternary complexes with CHRD and BMPs, thereby preventing BMPs from binding to their receptors. In addition to the anti-BMP function, also has pro-BMP activity, partly mediated by cleavage and degradation of CHRD, which releases BMPs from ternary complexes. May be an important modulator of BMP-regulated cartilage development and chondrocyte differentiation. May play a role in thymocyte development.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

TWSG1 Antibody

42983-100ul 100ul
EUR 252

TWSG1 siRNA

20-abx938631
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TWSG1 siRNA

20-abx938632
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223- TWSG1

PVT11463 2 ug
EUR 273

anti-TWSG1

YF-PA26453 50 ul
EUR 334
Description: Mouse polyclonal to TWSG1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

TWSG1 Recombinant Protein (Rat)

RP235358 100 ug Ask for price

TWSG1 Recombinant Protein (Mouse)

RP182351 100 ug Ask for price

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human TWSG1 shRNA Plasmid

20-abx961297
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Protein pellino homolog 1 ELISA kit

E01P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein pellino homolog 1 ELISA kit

E01P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein pellino homolog 1 ELISA kit

E01P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TWSG1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2562802 1.0 ug DNA
EUR 154

TWSG1 Conjugated Antibody

C42983 100ul
EUR 397

TWSG1 cloning plasmid

CSB-CL863935HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 672
  • Sequence: atgaagttacactatgttgctgtgcttactctagccatcctgatgttcctgacatggcttccagaatcactgagctgtaacaaagcactctgtgctagtgatgtgagcaaatgcctcattcaggagctctgccagtgccggccgggagaaggcaattgctcctgctgtaaggagtg
  • Show more
Description: A cloning plasmid for the TWSG1 gene.

anti- TWSG1 antibody

FNab09120 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: twisted gastrulation homolog 1
  • Uniprot ID: Q9GZX9
  • Gene ID: 57045
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against TWSG1

Anti-TWSG1 antibody

PAab09120 100 ug
EUR 386

Anti-TWSG1 (6E6)

YF-MA19011 100 ug
EUR 363
Description: Mouse monoclonal to TWSG1

Anti-TWSG1 (2F3)

YF-MA19012 100 ug
EUR 363
Description: Mouse monoclonal to TWSG1

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Anti-CELSR3/Flamingo Homolog 1 Antibody

A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

Human Protein sel-1 homolog 1(SEL1L) ELISA kit

CSB-EL020973HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein sel-1 homolog 1 (SEL1L) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein sel-1 homolog 1(SEL1L) ELISA kit

1-CSB-EL020973HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein sel-1 homolog 1(SEL1L) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human DLK-1(Protein delta homolog 1 ) ELISA Kit

EH0575 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P80370
  • Alias: DLK-1/DLK1/FA1/PREF1/Pref-1/ZOG/pG2/delta-like 1 homolog(Drosophila)/DLK/fetal antigen 1/pG2delta-like homolog(Drosophila)/preadipocyte factor 1/protein delta homolog 1/secredeltin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Protein sel- 1 homolog 1, SEL1L ELISA KIT

ELI-30517h 96 Tests
EUR 824

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Human Notch Homolog 1 ELISA kit

E01N0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit

E01N0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit

E01N0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit

EK2802-1 96 Well Plate
EUR 477

Human Protein patched homolog 1(PTCH1) ELISA kit

CSB-EL018956HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein patched homolog 1 (PTCH1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein patched homolog 1(PTCH1) ELISA kit

1-CSB-EL018956HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein patched homolog 1(PTCH1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human seminal plasma protein homolog 1 ELISA kit

E01B0856-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human seminal plasma protein homolog 1 ELISA kit

E01B0856-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human seminal plasma protein homolog 1 ELISA kit

E01B0856-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ATOH1/ Protein atonal homolog 1 ELISA Kit

E0224Hu 1 Kit
EUR 605

Human Chromobox protein homolog 1(CBX1) ELISA kit

E01C1420-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chromobox protein homolog 1(CBX1) ELISA kit

E01C1420-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chromobox protein homolog 1(CBX1) ELISA kit

E01C1420-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein Atonal Homolog 1 (ATOH1) ELISA Kit

abx253762-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human DLK1/ Protein delta homolog 1 ELISA Kit

E0703Hu 1 Kit
EUR 537

Human ATOH1(Protein atonal homolog 1) ELISA Kit

EH0804 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: Q92858
  • Alias: ATOH1(Protein atonal homolog 1)/ATH1/Class A basic helix-loop-helix protein 14(bHLHa14)/Helix-loop-helix protein hATH-1(hATH1)/BHLHA14
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Protein patched homolog 1, PTCH1 ELISA KIT

ELI-14033h 96 Tests
EUR 824

Human Protein tweety homolog 1, TTYH1 ELISA KIT

ELI-17044h 96 Tests
EUR 824

Human Protein canopy homolog 1, CNPY1 ELISA KIT

ELI-10076h 96 Tests
EUR 824

Human Protein chibby homolog 1, CBY1 ELISA KIT

ELI-10764h 96 Tests
EUR 824

Human Protein angel homolog 1, ANGEL1 ELISA KIT

ELI-11501h 96 Tests
EUR 824

Human Protein spire homolog 1, SPIRE1 ELISA KIT

ELI-18268h 96 Tests
EUR 824

Human Slit homolog 1 protein, SLIT1 ELISA KIT

ELI-18717h 96 Tests
EUR 824

Human Protein Smaug homolog 1, SAMD4A ELISA KIT

ELI-18721h 96 Tests
EUR 824

Human Protein flightless- 1 homolog, FLII ELISA KIT

ELI-20816h 96 Tests
EUR 824

Human Protein Hook homolog 1, HOOK1 ELISA KIT

ELI-20843h 96 Tests
EUR 824

Human Protein zer- 1 homolog, ZER1 ELISA KIT

ELI-21849h 96 Tests
EUR 824

Human Protein misato homolog 1, MSTO1 ELISA KIT

ELI-23224h 96 Tests
EUR 824

Human Notchless protein homolog 1, NLE1 ELISA KIT

ELI-23640h 96 Tests
EUR 824

Human Protein spinster homolog 1, SPNS1 ELISA KIT

ELI-30037h 96 Tests
EUR 824

Human Protein delta homolog 1, DLK1 ELISA KIT

ELI-03465h 96 Tests
EUR 824

Human Protein DDI1 homolog 1, DDI1 ELISA KIT

ELI-26365h 96 Tests
EUR 824

Human Protein diaphanous homolog 1, DIAPH1 ELISA KIT

ELI-08272h 96 Tests
EUR 824

Human Protein salvador homolog 1, SAV1 ELISA KIT

ELI-42110h 96 Tests
EUR 824

Human Protein HEG homolog 1, HEG1 ELISA KIT

ELI-43926h 96 Tests
EUR 824

Human Protein delta homolog 1(DLK1) ELISA kit

CSB-EL006945HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein delta homolog 1 (DLK1) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein delta homolog 1(DLK1) ELISA kit

1-CSB-EL006945HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein delta homolog 1(DLK1) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Protein zer-1 homolog (ZER1) ELISA Kit

abx384392-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protein misato homolog 1 (MSTO1) ELISA Kit

abx385159-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protein salvador homolog 1 (SAV1) ELISA Kit

abx385382-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protein patched homolog 1 (PTCH1) ELISA Kit

abx382549-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protein delta homolog 1 (DLK1) ELISA Kit

abx573388-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Protein Chibby Homolog 1 (CBY1) ELISA Kit

20-abx386320
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Protein DDI1 Homolog 1 (DDI1) ELISA Kit

abx386823-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protein dispatched homolog 1 (DISP1) ELISA Kit

abx386894-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protein Hook Homolog 1 (HOOK1) ELISA Kit

abx387850-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protein dispatched homolog 1, DISP1 ELISA KIT

ELI-31941h 96 Tests
EUR 824

Human Protein asteroid homolog 1, ASTE1 ELISA KIT

ELI-34777h 96 Tests
EUR 824

Human Protein PAT1 homolog 1, PATL1 ELISA KIT

ELI-35756h 96 Tests
EUR 824

Human PMS1 protein homolog 1, PMS1 ELISA KIT

ELI-38092h 96 Tests
EUR 824

Human Protein jagunal homolog 1, JAGN1 ELISA KIT

ELI-38160h 96 Tests
EUR 824

Human Protein slowmo homolog 1, SLMO1 ELISA KIT

ELI-41003h 96 Tests
EUR 824

Human Protein sprouty homolog 1, SPRY1 ELISA KIT

ELI-41452h 96 Tests
EUR 824

Human Homer protein homolog 1, HOMER1 ELISA KIT

ELI-48682h 96 Tests
EUR 824

Human Chromobox protein homolog 1, CBX1 ELISA KIT

ELI-49038h 96 Tests
EUR 824

Human Protein NipSnap homolog 1, NIPSNAP1 ELISA KIT

ELI-36966h 96 Tests
EUR 824

Human Homer protein homolog 1(HOMER1)ELISA Kit

QY-E05396 96T
EUR 361

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

TWSG1 ORF Vector (Human) (pORF)

ORF011180 1.0 ug DNA
EUR 95

TWSG1 Protein Vector (Human) (pPB-C-His)

PV044717 500 ng
EUR 329

TWSG1 Protein Vector (Human) (pPB-N-His)

PV044718 500 ng
EUR 329

TWSG1 Protein Vector (Human) (pPM-C-HA)

PV044719 500 ng
EUR 329

TWSG1 Protein Vector (Human) (pPM-C-His)

PV044720 500 ng
EUR 329

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit

EH5215-1 96 Well Plate
EUR 417

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Rat Protein pellino homolog 1 ELISA kit

E02P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein pellino homolog 1 ELISA kit

E02P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein pellino homolog 1 ELISA kit

E02P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein pellino homolog 1 ELISA kit

E04P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein pellino homolog 1 ELISA kit

E04P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein pellino homolog 1 ELISA kit

E04P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit

E03P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit

E03P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit

E03P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein pellino homolog 1 ELISA kit

E08P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein pellino homolog 1 ELISA kit

E08P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein pellino homolog 1 ELISA kit

E08P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein pellino homolog 1 ELISA kit

E06P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein pellino homolog 1 ELISA kit

E06P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein pellino homolog 1 ELISA kit

E06P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein pellino homolog 1 ELISA kit

E07P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein pellino homolog 1 ELISA kit

E07P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein pellino homolog 1 ELISA kit

E07P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein pellino homolog 1 ELISA kit

E09P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein pellino homolog 1 ELISA kit

E09P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein pellino homolog 1 ELISA kit

E09P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Human WAS protein family homolog 1(WASH1) ELISA kit

E01W0003-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human WAS protein family homolog 1(WASH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human WAS protein family homolog 1(WASH1) ELISA kit

E01W0003-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human WAS protein family homolog 1(WASH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human WAS protein family homolog 1(WASH1) ELISA kit

E01W0003-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human WAS protein family homolog 1(WASH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human seminal plasma protein homolog 1(BSPH1) ELISA kit

E01S0303-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1(BSPH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human seminal plasma protein homolog 1(BSPH1) ELISA kit

E01S0303-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1(BSPH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human seminal plasma protein homolog 1(BSPH1) ELISA kit

E01S0303-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1(BSPH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein fem-1 homolog A (FEM1A) ELISA Kit

abx251652-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human FEM1A(Protein fem-1 homolog A) ELISA Kit

EH2300 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q9BSK4
  • Alias: FEM1A/FEM1a/FEM1-alpha/Prostaglandin E receptor 4-associated protein/FEM1A/EPRAP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human TWSG1(Twisted Gastrulation Protein Homolog 1) ELISA Kit