Mouse JAG1(Jagged 1 Protein) ELISA Kit

Mouse JAG1(Jagged 1 Protein) ELISA Kit

To Order: Contact us

Mouse Jagged 1 Protein (JAG1) ELISA Kit
RD-JAG1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Jagged 1 Protein (JAG1) ELISA Kit
RD-JAG1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Human Jagged 1 Protein (JAG1) ELISA Kit
DLR-JAG1-Hu-48T	DL Develop	48T	EUR 498
Should the Human Jagged 1 Protein (JAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Jagged 1 Protein (JAG1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit
DLR-JAG1-Hu-96T	DL Develop	96T	EUR 647
Should the Human Jagged 1 Protein (JAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Jagged 1 Protein (JAG1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit
RDR-JAG1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Jagged 1 Protein (JAG1) ELISA Kit
RDR-JAG1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Jagged 1 Protein (JAG1) ELISA Kit
RD-JAG1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Jagged 1 Protein (JAG1) ELISA Kit
RD-JAG1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Protein jagged-1 (Jag1)
1-CSB-EP870758MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 53.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Protein jagged-1(Jag1),partial expressed in E.coli

Mouse Jagged 1 Protein (JAG1) ELISA Kit
20-abx154277	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Jag1/ Protein jagged-1 ELISA Kit
E0818Mo	Sunlong	1 Kit	EUR 571

Mouse Protein jagged- 1, Jag1 ELISA KIT
ELI-06945m	Lifescience Market	96 Tests	EUR 865

Mouse Protein jagged-1 (JAG1) ELISA Kit
abx571056-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Jagged 1 Protein (JAG1) ELISA Kit
SEB807Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids.

Mouse Jagged 1 Protein (JAG1) ELISA Kit
SEB807Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids.

Mouse Jagged 1 Protein (JAG1) ELISA Kit
SEB807Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids.

Mouse Jagged 1 Protein (JAG1) ELISA Kit
SEB807Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids.

Mouse Jagged 1 Protein (JAG1) ELISA Kit
4-SEB807Mu	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Jagged 1 Protein elisa. Alternative names of the recognized antigen: CD339 AGS AHD AWS HJ1 JAGL1 Alagille Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Jagged 1 Protein (JAG1) in samples from Tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Jagged 1 Protein ELISA Kit (JAG1)
RK02964	Abclonal	96 Tests	EUR 521

Mouse Jagged 1 Protein (JAG1) Protein
20-abx165879	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Mouse JAG1 (Jagged 1 Protein)
ELK3597	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Jagged 1 Protein (JAG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Jagged 1 P Show more
Description: A sandwich ELISA kit for detection of Jagged 1 Protein from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Jagged 1 Protein (JAG1) CLIA Kit
20-abx493102	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Jag1/ Protein jagged-1 ELISA Kit
E0537Ra	Sunlong	1 Kit	EUR 571

Human Jagged 1 Protein (JAG1) ELISA Kit
20-abx152071	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Protein jagged-1 (JAG1) ELISA Kit
abx256614-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Jagged 1 Protein, JAG1 ELISA Kit
ELA-E2164h	Lifescience Market	96 Tests	EUR 824

Human JAG1/ Protein jagged-1 ELISA Kit
E1358Hu	Sunlong	1 Kit	EUR 571

Rat Protein jagged- 1, Jag1 ELISA KIT
ELI-06944r	Lifescience Market	96 Tests	EUR 886

Human Protein jagged- 1, JAG1 ELISA KIT
ELI-06946h	Lifescience Market	96 Tests	EUR 824

Human Protein jagged-1(JAG1) ELISA kit
CSB-EL011927HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein jagged-1 (JAG1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein jagged-1(JAG1) ELISA kit
1-CSB-EL011927HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein jagged-1(JAG1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Protein jagged-1 (JAG1) ELISA Kit
abx570714-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Jag1(Protein jagged-1) ELISA Kit
ER0639	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: Q63722 Alias: Jag1/CD339/AGS/AHDMGC104644/Alagille syndrome/AWS/CD339/CD339 antigen/HJ1/hJ1/jagged 1/Jagged1/JAGL1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.9pg/ml

Human Jagged 1 Protein(JAG1)ELISA Kit
QY-E04851	Qayee Biotechnology	96T	EUR 394

Human Jagged 1 Protein ELISA Kit (JAG1)
RK01715	Abclonal	96 Tests	EUR 521

Human Jagged 1 Protein (JAG1) ELISA Kit
SEB807Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit
SEB807Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit
SEB807Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit
SEB807Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit
4-SEB807Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Jagged 1 Protein elisa. Alternative names of the recognized antigen: CD339 AGS AHD AWS HJ1 JAGL1 Alagille Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Jagged 1 Protein (JAG1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Protein Jagged-1 (JAG1) Antibody
20-abx213868	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody
20-abx214943	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody
abx216340-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Jagged 1 Protein (JAG1) Antibody
20-abx177228	Abbexa	EUR 1177.00 EUR 578.00	1 mg 200 ug
Please enquire.

Jagged 1 Protein (JAG1) Antibody
20-abx101517	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Jagged 1 Protein (JAG1) Antibody
20-abx101518	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Jagged 1 Protein (JAG1) Antibody
20-abx101519	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Protein Jagged-1 (JAG1) Antibody
abx037271-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody
abx038125-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Jagged 1 Protein (JAG1) Antibody
20-abx129567	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Jagged 1 Protein (JAG1) Antibody
20-abx173207	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Protein Jagged-1 (JAG1) Antibody
20-abx327592	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody
abx431368-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Protein Jagged-1 (JAG1) Antibody
20-abx302273	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Jagged 1 Protein (JAG1)
4-RPB807Hu01	Cloud-Clone	EUR 431.52 EUR 218.00 EUR 1343.20 EUR 514.40 EUR 928.80 EUR 352.00 EUR 3208.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P78504 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 25.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Jagged 1 Protein expressed in: E.coli

Recombinant Jagged 1 Protein (JAG1)
4-RPB807Hu02	Cloud-Clone	EUR 431.52 EUR 218.00 EUR 1343.20 EUR 514.40 EUR 928.80 EUR 352.00 EUR 3208.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P78504 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 41.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Jagged 1 Protein expressed in: E.coli

Recombinant Jagged 1 Protein (JAG1)
4-RPB807Hu03	Cloud-Clone	EUR 431.52 EUR 218.00 EUR 1343.20 EUR 514.40 EUR 928.80 EUR 352.00 EUR 3208.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P78504 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 24.3kDa Isoelectric Point: 5.7
Description: Recombinant Human Jagged 1 Protein expressed in: E.coli

Recombinant Jagged 1 Protein (JAG1)
4-RPB807Mu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9QXX0 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.0kDa Isoelectric Point: 6.7
Description: Recombinant Mouse Jagged 1 Protein expressed in: E.coli

Human Jagged 1 Protein (JAG1) Protein
20-abx067570	Abbexa	EUR 606.00 EUR 258.00 EUR 1817.00 EUR 718.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Jagged 1 Protein (JAG1) Protein
20-abx067571	Abbexa	EUR 606.00 EUR 258.00 EUR 1817.00 EUR 718.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Jagged 1 Protein (JAG1) Protein
20-abx067572	Abbexa	EUR 606.00 EUR 258.00 EUR 1817.00 EUR 718.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse)
4-PAB807Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1)

ELISA kit for Human JAG1 (Jagged 1 Protein)
ELK3156	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Jagged 1 Protein (JAG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Jagged 1 P Show more
Description: A sandwich ELISA kit for detection of Jagged 1 Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Jag1 ELISA Kit| Rat Protein jagged-1 ELISA Kit
EF017455	Lifescience Market	96 Tests	EUR 689

Human Jagged 1 Protein (JAG1) CLIA Kit
20-abx493101	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Jagged 1 Protein (JAG1) Antibody (Biotin)
20-abx272192	Abbexa	EUR 439.00 EUR 244.00 EUR 1261.00 EUR 606.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Protein Jagged-1 (JAG1) Antibody (HRP)
20-abx315963	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody (FITC)
20-abx315964	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody (Biotin)
20-abx315965	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Jagged 1 Protein (JAG1) Antibody (Biotin)
20-abx274491	Abbexa	EUR 439.00 EUR 244.00 EUR 1247.00 EUR 606.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Recombinant Human Jagged-1/JAG1 Protein
RP00877	Abclonal	10 μg	EUR 221

Jagged 1 (JAG1) polyclonal antibody
ABP-PAB-10531	Allele Biotech	100 ug	Ask for price
Product line: Cell Surface Molecules / GPCRs Brand:

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), APC
4-PAB807Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with APC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), Biotinylated
4-PAB807Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with Biotin.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), Cy3
4-PAB807Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with Cy3.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), FITC
4-PAB807Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with FITC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), HRP
4-PAB807Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with HRP.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), PE
4-PAB807Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with PE.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig)
4-PAB807Hu03	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1)

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB807Mu01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat)
4-PAB807Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1)

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat)
4-PAB807Hu02	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1)

Polyclonal JAG1 / Jagged 1 Antibody (aa110-125)
AMM06032G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JAG1 / Jagged 1 (aa110-125). This antibody is tested and proven to work in the following applications:

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), APC
4-PAB807Hu03-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with APC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated
4-PAB807Hu03-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with Biotin.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), Cy3
4-PAB807Hu03-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with Cy3.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), FITC
4-PAB807Hu03-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with FITC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), HRP
4-PAB807Hu03-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with HRP.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), PE
4-PAB807Hu03-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with PE.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC
4-PAB807Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAB807Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Biotin.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Cy3
4-PAB807Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Cy3.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), FITC
4-PAB807Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with FITC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), HRP
4-PAB807Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with HRP.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), PE
4-PAB807Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with PE.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC
4-PAB807Hu02-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAB807Hu02-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Biotin.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Cy3
4-PAB807Hu02-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Cy3.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), FITC
4-PAB807Hu02-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with FITC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), HRP
4-PAB807Hu02-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with HRP.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), PE
4-PAB807Hu02-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with PE.

Recombinant Human Jagged-1/JAG1/CD339 (C-Fc)
CB95-10ug	Novoprotein	10ug	EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Jagged-1/JAG1/CD339 (C-Fc)
CB95-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Jagged-1/JAG1/CD339 (C-Fc)
CB95-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Jagged-1/JAG1/CD339 (C-Fc)
CB95-50ug	Novoprotein	50ug	EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7
4-PAB807Hu03-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7.

Mouse Jagged 1 Protein ELISA kit
E03J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Jagged 1 Protein ELISA kit
E03J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Jagged 1 Protein ELISA kit
E03J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAB807Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAB807Hu02-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7.

Rat Jagged 1 Protein ELISA kit
E02J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Jagged 1 Protein ELISA kit
E02J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Jagged 1 Protein ELISA kit
E02J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Jagged 1 Protein ELISA kit
E04J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Jagged 1 Protein ELISA kit
E04J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Jagged 1 Protein ELISA kit
E04J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Jagged 1 Protein ELISA kit
E01J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Jagged 1 Protein ELISA kit
E01J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Jagged 1 Protein ELISA kit
E01J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Jagged 1 Protein ELISA kit
E09J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Jagged 1 Protein ELISA kit
E09J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Jagged 1 Protein ELISA kit
E09J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Jagged 1 Protein ELISA kit
E06J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Jagged 1 Protein ELISA kit
E06J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Jagged 1 Protein ELISA kit
E06J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Jagged 1 Protein ELISA kit
E08J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Jagged 1 Protein ELISA kit
E08J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Jagged 1 Protein ELISA kit
E08J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Jagged 1 Protein ELISA kit
E07J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Jagged 1 Protein ELISA kit
E07J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Jagged 1 Protein ELISA kit
E07J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

JAG1 ELISA Kit (Mouse) (OKCD02667)
OKCD02667	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Ligand for multiple Notch receptors and involved in the mediation of Notch signaling. May be involved in cell-fate decisions during hematopoiesis. Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation. May regulate fibroblast growth factor-induced angiogenesis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: < 6.1 pg/mL

Guinea pig Jagged 1 Protein ELISA kit
E05J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Jagged 1 Protein ELISA kit
E05J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Jagged 1 Protein ELISA kit
E05J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Protein jagged-1
EK4347	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein jagged-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Protein jagged-1
EK4348	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Protein jagged-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Jag2/ Protein jagged-2 ELISA Kit
E0819Mo	Sunlong	1 Kit	EUR 632

Mouse Protein Jagged-2 (JAG2) ELISA Kit
abx555988-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Mouse Protein jagged- 2, Jag2 ELISA KIT
ELI-47812m	Lifescience Market	96 Tests	EUR 865

Jag2 ELISA Kit| Mouse Protein jagged-2 ELISA Kit
EF015300	Lifescience Market	96 Tests	EUR 689

Jagged 1 Antibody
3101-100	Biovision		EUR 316

Jagged 1 Antibody
3101-30T	Biovision		EUR 146

Jagged 1 Antibody
48255-100ul	SAB	100ul	EUR 333

Jagged 1 Antibody
48255-50ul	SAB	50ul	EUR 239

JAG1 ELISA Kit (Human) (OKCD02666)
OKCD02666	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Ligand for multiple Notch receptors and involved in the mediation of Notch signaling. May be involved in cell-fate decisions during hematopoiesis. Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation. Enhances fibroblast growth factor-induced angiogenesis (in vitro).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

JAG1 ELISA Kit (Rat) (OKEH03468)
OKEH03468	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Ligand for multiple Notch receptors and involved in the mediation of Notch signaling. May be involved in cell-fate decisions during hematopoiesis. Enhances fibroblast growth factor-induced angiogenesis (in vitro). Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation. May regulate fibroblast growth factor-induced angiogenesis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.2 pg/mL

Human Jagged 2 Protein (JAG2) ELISA Kit
DLR-JAG2-Hu-48T	DL Develop	48T	EUR 554
Should the Human Jagged 2 Protein (JAG2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Jagged 2 Protein (JAG2) in samples from serum, plasma or other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit
DLR-JAG2-Hu-96T	DL Develop	96T	EUR 725
Should the Human Jagged 2 Protein (JAG2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Jagged 2 Protein (JAG2) in samples from serum, plasma or other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit
20-abx152072	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Protein jagged- 2, JAG2 ELISA KIT
ELI-19919h	Lifescience Market	96 Tests	EUR 824

Rat Protein Jagged-2 (JAG2) ELISA Kit
abx556259-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Human Protein Jagged-2 (JAG2) ELISA Kit
abx573196-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Human Jagged 2 Protein(JAG2)ELISA Kit
QY-E04850	Qayee Biotechnology	96T	EUR 394

Human Jagged 2 Protein (JAG2) ELISA Kit
RDR-JAG2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Jagged 2 Protein (JAG2) ELISA Kit
RDR-JAG2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Jagged 2 Protein (JAG2) ELISA Kit
RD-JAG2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Jagged 2 Protein (JAG2) ELISA Kit
RD-JAG2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Jagged 2 Protein (JAG2) ELISA Kit
SEL636Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit
SEL636Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit
SEL636Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit
SEL636Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit
4-SEL636Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Jagged 2 Protein elisa. Alternative names of the recognized antigen: HJ2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Jagged 2 Protein (JAG2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Jagged 2 Protein (JAG2) Protein
20-abx067573	Abbexa	EUR 662.00 EUR 272.00 EUR 2026.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Jagged 1 Blocking Peptide
3101BP-50	Biovision		EUR 153

Jagged 1 Conjugated Antibody
C48255	SAB	100ul	EUR 397

Polyclonal Jagged 1 Antibody
AMM06036G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Jagged 1 . This antibody is tested and proven to work in the following applications:

Mouse Jagged 1 Protein (Gln 34-Asp 1067)
VAng-1941Lsx-100g	Creative Biolabs	100 µg	EUR 1013
Description: Mouse Jagged 1 (JAG1) protein, expressed in human 293 cells. (Uniprot ID: Q9QXX0-1)

Mouse Jagged 1 Protein (Gln 34-Asp 1067)
VAng-1941Lsx-1mg	Creative Biolabs	1 mg	EUR 6402
Description: Mouse Jagged 1 (JAG1) protein, expressed in human 293 cells. (Uniprot ID: Q9QXX0-1)

Jag2 ELISA Kit| Rat Protein jagged-2 ELISA Kit
EF018869	Lifescience Market	96 Tests	EUR 689

Mouse JAG1 shRNA Plasmid
20-abx971116	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

JAG1 Antibody
37668-100ul	SAB	100ul	EUR 252

JAG1 Antibody
39567-100ul	SAB	100ul	EUR 390

JAG1 Antibody
1-CSB-PA005638	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

JAG1 Antibody
1-CSB-PA969766	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

JAG1 Antibody
DF8269	Affbiotech	200ul	EUR 304
Description: JAG1 Antibody detects endogenous levels of total JAG1.

JAG1 Antibody
1-CSB-PA234352	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

JAG1 Antibody
1-CSB-PA01949A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

JAG1 siRNA
20-abx902742	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

JAG1 siRNA
20-abx921012	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

JAG1 siRNA
20-abx921013	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

JAG1 Antibody
ABD8269	Lifescience Market	100 ug	EUR 438

Jag1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4373902	ABM	1.0 ug DNA	EUR 154

ELISA kit for Human JAG2 (Jagged 2 Protein)
ELK7225	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Jagged 2 Protein (JAG2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Jagged 2 P Show more
Description: A sandwich ELISA kit for detection of Jagged 2 Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

Jagged-1 (188-204) (TFA)
HY-P1846A	MedChemExpress	10mg	EUR 911

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Jag1 ORF Vector (Mouse) (pORF)
ORF048211	ABM	1.0 ug DNA	EUR 506

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

JAG1 Protein Vector (Mouse) (pPB-C-His)
PV192842	ABM	500 ng	EUR 1065

JAG1 Protein Vector (Mouse) (pPB-N-His)
PV192843	ABM	500 ng	EUR 1065

JAG1 Protein Vector (Mouse) (pPM-C-HA)
PV192844	ABM	500 ng	EUR 1065

JAG1 Protein Vector (Mouse) (pPM-C-His)
PV192845	ABM	500 ng	EUR 1065

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Jagged 2 Protein (JAG2) Polyclonal Antibody (Mouse)
4-PAL636Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG2 (Cys709~Pro941) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 2 Protein (JAG2)

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

JAG1 Rabbit pAb
A12733-100ul	Abclonal	100 ul	EUR 308

JAG1 Rabbit pAb
A12733-200ul	Abclonal	200 ul	EUR 459

JAG1 Rabbit pAb
A12733-20ul	Abclonal	20 ul	EUR 183

JAG1 Rabbit pAb
A12733-50ul	Abclonal	50 ul	EUR 223

JAG1 Rabbit pAb
A12754-100ul	Abclonal	100 ul	EUR 308

JAG1 Rabbit pAb
A12754-200ul	Abclonal	200 ul	EUR 459

JAG1 Rabbit pAb
A12754-20ul	Abclonal	20 ul	EUR 183

JAG1 Rabbit pAb
A12754-50ul	Abclonal	50 ul	EUR 223

JAG1 Blocking Peptide
DF8269-BP	Affbiotech	1mg	EUR 195

JAG1 Conjugated Antibody
C37668	SAB	100ul	EUR 397

Polyclonal JAG1 Antibody
AMM06033G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JAG1 . This antibody is tested and proven to work in the following applications:

JAG1 cloning plasmid
CSB-CL011927HU-10ug	Cusabio	10ug	EUR 1291
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3657 Sequence: atgcgttccccacggacgcgcggccggtccgggcgccccctaagcctcctgctcgccctgctctgtgccctgcgagccaaggtgtgtggggcctcgggtcagttcgagttggagatcctgtccatgcagaacgtgaacggggagctgcagaacgggaactgctgcggcggcgccc Show more
Description: A cloning plasmid for the JAG1 gene.

Anti-JAG1 antibody
STJ114606	St John's Laboratory	100 µl	EUR 277
Description: The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis.

Anti-JAG1 antibody
STJ114627	St John's Laboratory	100 µl	EUR 277
Description: The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis.

Anti-JAG1 Antibody
STJ193192	St John's Laboratory	200 µl	EUR 197

Anti-JAG1 antibody
STJ72591	St John's Laboratory	100 µg	EUR 359

Human Jagged 2 Protein (JAG2) CLIA Kit
20-abx495948	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Jagged 2 antibody
70R-5696	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Jagged 2 antibody raised against the N terminal of JAG2

anti-Jagged 2
YF-PA24029	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Jagged 2

Protein Jagged-2 (JAG2) Antibody
20-abx210332	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Jagged 2 Protein (JAG2) Antibody
20-abx101520	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Jagged 2 Protein (JAG2) Antibody
20-abx101521	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Jagged 2 Protein (JAG2) Antibody
20-abx173208	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Protein Jagged 2 (JAG2) Antibody
abx415142-025mg	Abbexa	0.25 mg	EUR 565
Shipped within 1 week.

Protein Jagged 2 (JAG2) Antibody
abx415143-01mg	Abbexa	0.1 mg	EUR 439
Shipped within 1 week.

Recombinant human Protein jagged-2
P1266	FN Test	100ug	Ask for price
Uniprot ID: Q9Y219 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Protein jagged-2

Recombinant Jagged 2 Protein (JAG2)
4-RPL636Hu01	Cloud-Clone	EUR 456.61 EUR 225.00 EUR 1437.28 EUR 545.76 EUR 991.52 EUR 368.00 EUR 3443.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9Y219 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.4kDa Isoelectric Point: 6.6
Description: Recombinant Human Jagged 2 Protein expressed in: E.coli

Recombinant Jagged 2 Protein (JAG2)
4-RPL636Mu01	Cloud-Clone	EUR 474.53 EUR 230.00 EUR 1504.48 EUR 568.16 EUR 1036.32 EUR 380.00 EUR 3611.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9QYE5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.9kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Jagged 2 Protein expressed in: E.coli

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Jagged 1 Protein (Gln 34-Asp 1067)
VAng-1857Lsx-1mg	Creative Biolabs	1 mg	EUR 6099
Description: Human Jagged 1 (JAG1) protein, expressed in human 293 cells. (Uniprot ID: P78504-1)

Mouse JAG1(Jagged 1 Protein) ELISA Kit