Mouse JAG1(Jagged 1 Protein) ELISA Kit

Mouse JAG1(Jagged 1 Protein) ELISA Kit

To Order: Contact us

Mouse Jagged 1 Protein (JAG1) ELISA Kit
RDR-JAG1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534

Mouse Jagged 1 Protein (JAG1) ELISA Kit
RDR-JAG1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742

Human Jagged 1 Protein (JAG1) ELISA Kit
DLR-JAG1-Hu-48T	DL Develop	48T	EUR 498
Should the Human Jagged 1 Protein (JAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Jagged 1 Protein (JAG1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit
DLR-JAG1-Hu-96T	DL Develop	96T	EUR 647
Should the Human Jagged 1 Protein (JAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Jagged 1 Protein (JAG1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit
RD-JAG1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Jagged 1 Protein (JAG1) ELISA Kit
RD-JAG1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Jagged 1 Protein (JAG1) ELISA Kit
RDR-JAG1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Jagged 1 Protein (JAG1) ELISA Kit
RDR-JAG1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Mouse Protein jagged-1 (Jag1)
1-CSB-EP870758MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 53.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Protein jagged-1(Jag1),partial expressed in E.coli

Mouse Protein jagged-1 (JAG1) ELISA Kit
abx571056-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Jag1/ Protein jagged-1 ELISA Kit
E0818Mo	Sunlong	1 Kit	EUR 571

Mouse Protein jagged- 1, Jag1 ELISA KIT
ELI-06945m	Lifescience Market	96 Tests	EUR 865

Mouse Jagged 1 Protein (JAG1) ELISA Kit
20-abx154277	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Jagged 1 Protein (JAG1) ELISA Kit
SEB807Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids.

Mouse Jagged 1 Protein (JAG1) ELISA Kit
SEB807Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids.

Mouse Jagged 1 Protein (JAG1) ELISA Kit
SEB807Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids.

Mouse Jagged 1 Protein (JAG1) ELISA Kit
SEB807Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids.

Mouse Jagged 1 Protein (JAG1) ELISA Kit
4-SEB807Mu	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Jagged 1 Protein elisa. Alternative names of the recognized antigen: CD339 AGS AHD AWS HJ1 JAGL1 Alagille Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Jagged 1 Protein (JAG1) in samples from Tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Jagged 1 Protein ELISA Kit (JAG1)
RK02964	Abclonal	96 Tests	EUR 521

Mouse Jagged 1 Protein (JAG1) Protein
20-abx165879	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Mouse JAG1 (Jagged 1 Protein)
ELK3597	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Jagged 1 Protein (JAG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Jagged 1 P Show more
Description: A sandwich ELISA kit for detection of Jagged 1 Protein from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Jagged 1 Protein (JAG1) CLIA Kit
20-abx493102	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Protein jagged-1 (JAG1) ELISA Kit
abx570714-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Jag1/ Protein jagged-1 ELISA Kit
E0537Ra	Sunlong	1 Kit	EUR 571

Human Jagged 1 Protein, JAG1 ELISA Kit
ELA-E2164h	Lifescience Market	96 Tests	EUR 824

Human JAG1/ Protein jagged-1 ELISA Kit
E1358Hu	Sunlong	1 Kit	EUR 571

Rat Protein jagged- 1, Jag1 ELISA KIT
ELI-06944r	Lifescience Market	96 Tests	EUR 886

Human Protein jagged- 1, JAG1 ELISA KIT
ELI-06946h	Lifescience Market	96 Tests	EUR 824

Rat Jag1(Protein jagged-1) ELISA Kit
ER0639	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: Q63722 Alias: Jag1/CD339/AGS/AHDMGC104644/Alagille syndrome/AWS/CD339/CD339 antigen/HJ1/hJ1/jagged 1/Jagged1/JAGL1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.9pg/ml

Human Jagged 1 Protein (JAG1) ELISA Kit
20-abx152071	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Protein jagged-1 (JAG1) ELISA Kit
abx256614-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Protein jagged-1(JAG1) ELISA kit
CSB-EL011927HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein jagged-1 (JAG1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein jagged-1(JAG1) ELISA kit
1-CSB-EL011927HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein jagged-1(JAG1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Jagged 1 Protein (JAG1) ELISA Kit
SEB807Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit
SEB807Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit
SEB807Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit
SEB807Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit
4-SEB807Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Jagged 1 Protein elisa. Alternative names of the recognized antigen: CD339 AGS AHD AWS HJ1 JAGL1 Alagille Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Jagged 1 Protein (JAG1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Jagged 1 Protein ELISA Kit (JAG1)
RK01715	Abclonal	96 Tests	EUR 521

Human Jagged 1 Protein(JAG1)ELISA Kit
QY-E04851	Qayee Biotechnology	96T	EUR 394

Jagged 1 Protein (JAG1) Antibody
20-abx129567	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Jagged 1 Protein (JAG1) Antibody
20-abx101517	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Jagged 1 Protein (JAG1) Antibody
20-abx101518	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Jagged 1 Protein (JAG1) Antibody
20-abx101519	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Protein Jagged-1 (JAG1) Antibody
abx037271-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody
abx038125-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Jagged 1 Protein (JAG1) Antibody
20-abx173207	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Jagged 1 Protein (JAG1) Antibody
20-abx177228	Abbexa	EUR 1177.00 EUR 578.00	1 mg 200 ug
Please enquire.

Protein Jagged-1 (JAG1) Antibody
20-abx327592	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody
20-abx213868	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody
20-abx214943	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody
abx216340-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody
abx431368-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Protein Jagged-1 (JAG1) Antibody
20-abx302273	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Jagged 1 Protein (JAG1)
4-RPB807Hu01	Cloud-Clone	EUR 431.52 EUR 218.00 EUR 1343.20 EUR 514.40 EUR 928.80 EUR 352.00 EUR 3208.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P78504 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 25.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Jagged 1 Protein expressed in: E.coli

Recombinant Jagged 1 Protein (JAG1)
4-RPB807Hu02	Cloud-Clone	EUR 431.52 EUR 218.00 EUR 1343.20 EUR 514.40 EUR 928.80 EUR 352.00 EUR 3208.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P78504 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 41.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Jagged 1 Protein expressed in: E.coli

Recombinant Jagged 1 Protein (JAG1)
4-RPB807Hu03	Cloud-Clone	EUR 431.52 EUR 218.00 EUR 1343.20 EUR 514.40 EUR 928.80 EUR 352.00 EUR 3208.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P78504 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 24.3kDa Isoelectric Point: 5.7
Description: Recombinant Human Jagged 1 Protein expressed in: E.coli

Recombinant Jagged 1 Protein (JAG1)
4-RPB807Mu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9QXX0 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.0kDa Isoelectric Point: 6.7
Description: Recombinant Mouse Jagged 1 Protein expressed in: E.coli

Human Jagged 1 Protein (JAG1) Protein
20-abx067570	Abbexa	EUR 606.00 EUR 258.00 EUR 1817.00 EUR 718.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Jagged 1 Protein (JAG1) Protein
20-abx067571	Abbexa	EUR 606.00 EUR 258.00 EUR 1817.00 EUR 718.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Jagged 1 Protein (JAG1) Protein
20-abx067572	Abbexa	EUR 606.00 EUR 258.00 EUR 1817.00 EUR 718.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse)
4-PAB807Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1)

ELISA kit for Human JAG1 (Jagged 1 Protein)
ELK3156	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Jagged 1 Protein (JAG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Jagged 1 P Show more
Description: A sandwich ELISA kit for detection of Jagged 1 Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Jag1 ELISA Kit| Rat Protein jagged-1 ELISA Kit
EF017455	Lifescience Market	96 Tests	EUR 689

Human Jagged 1 Protein (JAG1) CLIA Kit
20-abx493101	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Jagged 1 Protein (JAG1) Antibody (Biotin)
20-abx274491	Abbexa	EUR 439.00 EUR 244.00 EUR 1247.00 EUR 606.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Protein Jagged-1 (JAG1) Antibody (HRP)
20-abx315963	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody (FITC)
20-abx315964	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody (Biotin)
20-abx315965	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Jagged 1 Protein (JAG1) Antibody (Biotin)
20-abx272192	Abbexa	EUR 439.00 EUR 244.00 EUR 1261.00 EUR 606.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Recombinant Human Jagged-1/JAG1 Protein
RP00877	Abclonal	10 μg	EUR 221

Jagged 1 (JAG1) polyclonal antibody
ABP-PAB-10531	Allele Biotech	100 ug	Ask for price
Product line: Cell Surface Molecules / GPCRs Brand:

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), APC
4-PAB807Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with APC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), Biotinylated
4-PAB807Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with Biotin.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), Cy3
4-PAB807Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with Cy3.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), FITC
4-PAB807Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with FITC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), HRP
4-PAB807Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with HRP.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), PE
4-PAB807Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with PE.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig)
4-PAB807Hu03	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1)

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB807Mu01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Ser826~Cys1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat)
4-PAB807Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1)

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat)
4-PAB807Hu02	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1)

Polyclonal JAG1 / Jagged 1 Antibody (aa110-125)
AMM06032G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JAG1 / Jagged 1 (aa110-125). This antibody is tested and proven to work in the following applications:

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), APC
4-PAB807Hu03-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with APC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated
4-PAB807Hu03-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with Biotin.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), Cy3
4-PAB807Hu03-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with Cy3.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), FITC
4-PAB807Hu03-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with FITC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), HRP
4-PAB807Hu03-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with HRP.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), PE
4-PAB807Hu03-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with PE.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC
4-PAB807Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAB807Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Biotin.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Cy3
4-PAB807Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Cy3.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), FITC
4-PAB807Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with FITC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), HRP
4-PAB807Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with HRP.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), PE
4-PAB807Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with PE.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC
4-PAB807Hu02-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAB807Hu02-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Biotin.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Cy3
4-PAB807Hu02-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Cy3.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), FITC
4-PAB807Hu02-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with FITC.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), HRP
4-PAB807Hu02-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with HRP.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), PE
4-PAB807Hu02-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with PE.

Recombinant Human Jagged-1/JAG1/CD339 (C-Fc)
CB95-10ug	Novoprotein	10ug	EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Jagged-1/JAG1/CD339 (C-Fc)
CB95-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Jagged-1/JAG1/CD339 (C-Fc)
CB95-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Jagged-1/JAG1/CD339 (C-Fc)
CB95-50ug	Novoprotein	50ug	EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7
4-PAB807Hu03-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Val836~Ser1047) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7.

Mouse Jagged 1 Protein ELISA kit
E03J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Jagged 1 Protein ELISA kit
E03J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Jagged 1 Protein ELISA kit
E03J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAB807Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly33~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7.

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAB807Hu02-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG1 (Gly470~Thr834) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7.

Goat Jagged 1 Protein ELISA kit
E06J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Jagged 1 Protein ELISA kit
E06J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Jagged 1 Protein ELISA kit
E06J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Jagged 1 Protein ELISA kit
E02J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Jagged 1 Protein ELISA kit
E02J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Jagged 1 Protein ELISA kit
E02J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Jagged 1 Protein ELISA kit
E01J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Jagged 1 Protein ELISA kit
E01J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Jagged 1 Protein ELISA kit
E01J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Jagged 1 Protein ELISA kit
E04J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Jagged 1 Protein ELISA kit
E04J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Jagged 1 Protein ELISA kit
E04J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Jagged 1 Protein ELISA kit
E08J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Jagged 1 Protein ELISA kit
E08J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Jagged 1 Protein ELISA kit
E08J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Jagged 1 Protein ELISA kit
E07J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Jagged 1 Protein ELISA kit
E07J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Jagged 1 Protein ELISA kit
E07J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Jagged 1 Protein ELISA kit
E09J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Jagged 1 Protein ELISA kit
E09J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Jagged 1 Protein ELISA kit
E09J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

JAG1 ELISA Kit (Mouse) (OKCD02667)
OKCD02667	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Ligand for multiple Notch receptors and involved in the mediation of Notch signaling. May be involved in cell-fate decisions during hematopoiesis. Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation. May regulate fibroblast growth factor-induced angiogenesis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: < 6.1 pg/mL

Guinea pig Jagged 1 Protein ELISA kit
E05J0006-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Jagged 1 Protein ELISA kit
E05J0006-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Jagged 1 Protein ELISA kit
E05J0006-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Protein jagged-1
EK4347	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein jagged-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Protein jagged-1
EK4348	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Protein jagged-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Protein Jagged-2 (JAG2) ELISA Kit
abx555988-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Mouse Jag2/ Protein jagged-2 ELISA Kit
E0819Mo	Sunlong	1 Kit	EUR 632

Mouse Protein jagged- 2, Jag2 ELISA KIT
ELI-47812m	Lifescience Market	96 Tests	EUR 865

Jag2 ELISA Kit| Mouse Protein jagged-2 ELISA Kit
EF015300	Lifescience Market	96 Tests	EUR 689

Jagged 1 Antibody
48255-100ul	SAB	100ul	EUR 333

Jagged 1 Antibody
48255-50ul	SAB	50ul	EUR 239

Jagged 1 Antibody
3101-100	Biovision		EUR 316

Jagged 1 Antibody
3101-30T	Biovision		EUR 146

JAG1 ELISA Kit (Human) (OKCD02666)
OKCD02666	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Ligand for multiple Notch receptors and involved in the mediation of Notch signaling. May be involved in cell-fate decisions during hematopoiesis. Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation. Enhances fibroblast growth factor-induced angiogenesis (in vitro).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

JAG1 ELISA Kit (Rat) (OKEH03468)
OKEH03468	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Ligand for multiple Notch receptors and involved in the mediation of Notch signaling. May be involved in cell-fate decisions during hematopoiesis. Enhances fibroblast growth factor-induced angiogenesis (in vitro). Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation. May regulate fibroblast growth factor-induced angiogenesis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.2 pg/mL

Rat Protein Jagged-2 (JAG2) ELISA Kit
abx556259-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Human Protein Jagged-2 (JAG2) ELISA Kit
abx573196-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Human Protein jagged- 2, JAG2 ELISA KIT
ELI-19919h	Lifescience Market	96 Tests	EUR 824

Human Jagged 2 Protein (JAG2) ELISA Kit
20-abx152072	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Jagged 2 Protein (JAG2) ELISA Kit
DLR-JAG2-Hu-48T	DL Develop	48T	EUR 554
Should the Human Jagged 2 Protein (JAG2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Jagged 2 Protein (JAG2) in samples from serum, plasma or other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit
DLR-JAG2-Hu-96T	DL Develop	96T	EUR 725
Should the Human Jagged 2 Protein (JAG2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Jagged 2 Protein (JAG2) in samples from serum, plasma or other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit
RD-JAG2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Jagged 2 Protein (JAG2) ELISA Kit
RD-JAG2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Jagged 2 Protein (JAG2) ELISA Kit
RDR-JAG2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Jagged 2 Protein (JAG2) ELISA Kit
RDR-JAG2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Jagged 2 Protein(JAG2)ELISA Kit
QY-E04850	Qayee Biotechnology	96T	EUR 394

Human Jagged 2 Protein (JAG2) ELISA Kit
SEL636Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit
SEL636Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit
SEL636Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit
SEL636Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit
4-SEL636Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Jagged 2 Protein elisa. Alternative names of the recognized antigen: HJ2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Jagged 2 Protein (JAG2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Jagged 2 Protein (JAG2) Protein
20-abx067573	Abbexa	EUR 662.00 EUR 272.00 EUR 2026.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Polyclonal Jagged 1 Antibody
AMM06036G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Jagged 1 . This antibody is tested and proven to work in the following applications:

Jagged 1 Conjugated Antibody
C48255	SAB	100ul	EUR 397

Jagged 1 Blocking Peptide
3101BP-50	Biovision		EUR 153

Mouse Jagged 1 Protein (Gln 34-Asp 1067)
VAng-1941Lsx-100g	Creative Biolabs	100 µg	EUR 1013
Description: Mouse Jagged 1 (JAG1) protein, expressed in human 293 cells. (Uniprot ID: Q9QXX0-1)

Mouse Jagged 1 Protein (Gln 34-Asp 1067)
VAng-1941Lsx-1mg	Creative Biolabs	1 mg	EUR 6402
Description: Mouse Jagged 1 (JAG1) protein, expressed in human 293 cells. (Uniprot ID: Q9QXX0-1)

Jag2 ELISA Kit| Rat Protein jagged-2 ELISA Kit
EF018869	Lifescience Market	96 Tests	EUR 689

Mouse JAG1 shRNA Plasmid
20-abx971116	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

JAG1 siRNA
20-abx902742	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

JAG1 siRNA
20-abx921012	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

JAG1 siRNA
20-abx921013	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

JAG1 Antibody
ABD8269	Lifescience Market	100 ug	EUR 438

JAG1 Antibody
37668-100ul	SAB	100ul	EUR 252

JAG1 Antibody
39567-100ul	SAB	100ul	EUR 390

JAG1 Antibody
DF8269	Affbiotech	200ul	EUR 304
Description: JAG1 Antibody detects endogenous levels of total JAG1.

JAG1 Antibody
1-CSB-PA969766	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

JAG1 Antibody
1-CSB-PA005638	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

JAG1 Antibody
1-CSB-PA234352	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

JAG1 Antibody
1-CSB-PA01949A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Jag1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4373902	ABM	1.0 ug DNA	EUR 154

ELISA kit for Human JAG2 (Jagged 2 Protein)
ELK7225	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Jagged 2 Protein (JAG2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Jagged 2 P Show more
Description: A sandwich ELISA kit for detection of Jagged 2 Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

Jagged-1 (188-204) (TFA)
HY-P1846A	MedChemExpress	10mg	EUR 911

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Jag1 ORF Vector (Mouse) (pORF)
ORF048211	ABM	1.0 ug DNA	EUR 506

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

JAG1 Protein Vector (Mouse) (pPB-C-His)
PV192842	ABM	500 ng	EUR 1065

JAG1 Protein Vector (Mouse) (pPB-N-His)
PV192843	ABM	500 ng	EUR 1065

JAG1 Protein Vector (Mouse) (pPM-C-HA)
PV192844	ABM	500 ng	EUR 1065

JAG1 Protein Vector (Mouse) (pPM-C-His)
PV192845	ABM	500 ng	EUR 1065

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Jagged 2 Protein (JAG2) Polyclonal Antibody (Mouse)
4-PAL636Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: JAG2 (Cys709~Pro941) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 2 Protein (JAG2)

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Polyclonal JAG1 Antibody
AMM06033G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JAG1 . This antibody is tested and proven to work in the following applications:

JAG1 Conjugated Antibody
C37668	SAB	100ul	EUR 397

JAG1 cloning plasmid
CSB-CL011927HU-10ug	Cusabio	10ug	EUR 1291
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3657 Sequence: atgcgttccccacggacgcgcggccggtccgggcgccccctaagcctcctgctcgccctgctctgtgccctgcgagccaaggtgtgtggggcctcgggtcagttcgagttggagatcctgtccatgcagaacgtgaacggggagctgcagaacgggaactgctgcggcggcgccc Show more
Description: A cloning plasmid for the JAG1 gene.

JAG1 Rabbit pAb
A12733-100ul	Abclonal	100 ul	EUR 308

JAG1 Rabbit pAb
A12733-200ul	Abclonal	200 ul	EUR 459

JAG1 Rabbit pAb
A12733-20ul	Abclonal	20 ul	EUR 183

JAG1 Rabbit pAb
A12733-50ul	Abclonal	50 ul	EUR 223

JAG1 Rabbit pAb
A12754-100ul	Abclonal	100 ul	EUR 308

JAG1 Rabbit pAb
A12754-200ul	Abclonal	200 ul	EUR 459

JAG1 Rabbit pAb
A12754-20ul	Abclonal	20 ul	EUR 183

JAG1 Rabbit pAb
A12754-50ul	Abclonal	50 ul	EUR 223

JAG1 Blocking Peptide
DF8269-BP	Affbiotech	1mg	EUR 195

Anti-JAG1 antibody
STJ72591	St John's Laboratory	100 µg	EUR 359

Anti-JAG1 antibody
STJ114606	St John's Laboratory	100 µl	EUR 277
Description: The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis.

Anti-JAG1 antibody
STJ114627	St John's Laboratory	100 µl	EUR 277
Description: The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis.

Anti-JAG1 Antibody
STJ193192	St John's Laboratory	200 µl	EUR 197

Human Jagged 2 Protein (JAG2) CLIA Kit
20-abx495948	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Jagged 2 antibody
70R-5696	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Jagged 2 antibody raised against the N terminal of JAG2

anti-Jagged 2
YF-PA24029	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Jagged 2

Jagged 2 Protein (JAG2) Antibody
20-abx101520	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Jagged 2 Protein (JAG2) Antibody
20-abx101521	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Jagged 2 Protein (JAG2) Antibody
20-abx173208	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Protein Jagged 2 (JAG2) Antibody
abx415142-025mg	Abbexa	0.25 mg	EUR 565
Shipped within 1 week.

Protein Jagged 2 (JAG2) Antibody
abx415143-01mg	Abbexa	0.1 mg	EUR 439
Shipped within 1 week.

Protein Jagged-2 (JAG2) Antibody
20-abx210332	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant human Protein jagged-2
P1266	FN Test	100ug	Ask for price
Uniprot ID: Q9Y219 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Protein jagged-2

Recombinant Jagged 2 Protein (JAG2)
4-RPL636Hu01	Cloud-Clone	EUR 456.61 EUR 225.00 EUR 1437.28 EUR 545.76 EUR 991.52 EUR 368.00 EUR 3443.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9Y219 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.4kDa Isoelectric Point: 6.6
Description: Recombinant Human Jagged 2 Protein expressed in: E.coli

Recombinant Jagged 2 Protein (JAG2)
4-RPL636Mu01	Cloud-Clone	EUR 474.53 EUR 230.00 EUR 1504.48 EUR 568.16 EUR 1036.32 EUR 380.00 EUR 3611.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9QYE5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.9kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Jagged 2 Protein expressed in: E.coli

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Jagged 1 Protein (Gln 34-Asp 1067)
VAng-1857Lsx-1mg	Creative Biolabs	1 mg	EUR 6099
Description: Human Jagged 1 (JAG1) protein, expressed in human 293 cells. (Uniprot ID: P78504-1)

Mouse JAG1(Jagged 1 Protein) ELISA Kit